PK!ܚ[Content_Types].xml (TKO@v1A$b<)vY^iH(zi~|R<*kRM:,#m$eEDa lˋx#BL4w9)hu`[EW?NO1~piMPr~r1+B4\絓ݯZ)S$ pPRMv,޸JYrxEYBY7+=8  &|a}3+gN4y$y+.2[*ŚD7<I}d-mWhH_۸mansCj$uNQSgl1Iڌ)s/Di)D kUPK!N _rels/.rels (JA a}7 "Hw"w̤ھ P^O֛;<aYՠ؛`GkxmPY[g Gΰino/<<1ⳆA$>"f3\ȾTI SWY ig@X6_]7~ fˉao.b*lIrj),l0%b 6iD_, |uZ^t٢yǯ;!Y,}{C/h>PK!qFp;>word/_rels/document.xml.rels (N0HC;qSEi/+qvubȻ1JH\,y-|.Vv6eIf$l[ݼ>|h)gC1,S;iߪzԱÞf:<}37?zvоzdp۶5ö{k]]mWe,=V[ ļ%Ӭfo]Yv8C˾~#vwOG ݹggc6z3y!ʑBއ {fu @9einq3ee&K^d6 [1}_.p?QF-|y77ݜgJVCQ =h9xVQr\ƳG:Ǚlbir \V*MuニvE3{Y}3?}l+G' S&q9dX_p-13m`ힵg-tA[=hu4۔NC)Gx6jpwIʴl˺m˰lV BPv?o)' BOWo|o(\E=-7Wl^ ɩyN7;6J^h$VVR mnPO1 cQ:Fd8P]-?MdRG8Qmrt29:G(Eپl|3ה*`4^:+6j&Wd7#T,dԾ?rJ%Rw]]im 84 K ?t~әtݧ_ޓۧlҿ- ]ΜXSjiokK@?U5q4g՞ 軀#{-8z8اg:hɀe=&lzVOy2/ins<#wxdxGfwf\MQޔ͒Ur]~Hm8ʼn>f,V{~.FR[jpL_q}( tǎ9HFxPxgQg/Jy.n{>yF^[t 5XJHL) vjQU؝Q*jQ.LW`3ڳjتO$3}Yz~Rk1#ּ`2?Rml:G>[)f5BXuGWO.Q#rBJHt ue+šzT·fLL4 p(D{ kJl ({PsVClzh*rƌjtȭ~ %TT!Z/-+ %nB o(1sBR07|"sZ2L=^!2wiAzA0$yV^/w ,^^Bu\nɥ,w0Y h sV.+B`R&RJ-vPcb]se{@:վJV.3,9˲{~p_ǜ px#9c,/Bp}i^˿:cϪZ?~<?H/|9ޔi'}??4 lլY+%+צQ|WRr4|9{QI ,F95,1<*"O@O޾+`>ZEpX7kM󉲃jYEMpdP8zեR$]_\2> Uܙl.FB&yA0nJE1׽"XtO@F?n5K~,{K]BP@c|/]itSFMA"iHӅktO?Ҁ.oֺ׻fi]hq$|S`v837 mbFl|R Hy%-ͪ>^|#oRSwW=B  oJ*1@rpDﲗ N ;;q=Q`/52KrAT_J٬V+8%r6boK3l<:DQBل2ĭ s#cX0v V-U/:wַPs=0a;fUҀD61Fz,7t-=NoLjV]/ήUW{PDY@ƫo]XM ӏv #M; e\t4N"IgÛ5~eHI6Y bn\VA^Qte U7Ž6Μ| 4}9z+ݥQ-1_ض0.p2d&aZ!XAx;yw]66qG]淵:MXuOJhFe곃0]+z8Z7t9-X~9_]Z,e7k7^$6x@X>l+7W.)X78HcmZaX(hH֫ ݌gf,+#9s~+Y2a*J#;+|jp$Ȫt]n>=@[LeZJ l=giN+ɓ$ F7Ё0o(C}(ņ4UBY(?Z#K@bJ%JlX(FTh`'\" f$w")vg pǟ5'.G:m6Rc?NFmo6* p6H"נI=*W\KyěvrKqS@"Zq,dߨ74<gRtG\ƭjVQ(q2 rwi3=j}^Έx7 #X/ogǃ@ 43}9\`Uab2g2Šz1]Ӆ@ 4O8K&uɃ`? ӾV܉C;N"n?`&D' P ) g.̯r2^TKj=2+sgA(#4գtIӢC"Ԓn82R4юQ9)lfQ26}n|owD7Y%'`=d f~di3)%#b;`: ^ 6Krk$s^K^)2sXfĥoOEEW*TiLҒU:5&@=xy.ű岲ȘF(߁,ʎ'Č93!W̖r_ f7)^IK1[O jP&TʅZԱ fqb7)}sn݌u ^֕*Pm<=fCXB%TA;ut"בqV_?NG|$@I(8~>~<҅J\N)?)&P qK ^(]Ϛg*Dy>H_)0XjeR-2)^mЫpi&`_QItMIeYд؜;.jc肐]C%;J^=&a!˝p=T`B,\  2KZ֡hE{fZNs1 Ro܃Cp ;M=yPDTIbM{O/9@Qցd\j3iYu}v2\EJ2snG Ą2H7Jφ_< 8Sփ 3K{mhLokHte̙|i1 wz_;z&Nb5}sA4(xx*[CUu0C30OWjv;`CAAw{ GӥK:tt&U%tTtXjpNCËFAfıRLBT6Hz\%_,KH&yjd2-=ɵ>=Я]F*(}bӭ#|s8_N0) p Լ.]2 NV'eTx("!>7,WgJE^bư5 d 4@Ʋ-,9S"|'wG߰7+4/F`k K8k:gZR̩ l;%q:" 4s熴u* ep(l;mW/V1U[WbMաshM[p#^$LDLFas7hF ,ƚrqR12Bn-.$YYXSbk@]/E :1c P.qEO)ɢ2Bg ȩ*y.e-BcG5v週4sz[F@XYlu"SH Y>|ɠs`ai +'RBCm[( :VeR1 5| V$|+eQ:ކZ{ %`bQ. F3Ee%ٛR@t)֜Mh!*ţHv"ΓۦDlʱ?!sy0ۆnBnf%]Fx L u=~jEr"Xsn,7Wov$%#MP¬k%f֐AM\VċXze[˴^G4 s$M tBhb4[fWnp*%qmhƀ 9^>o!0-dEHr5u|/:F q幻,FB̝С6dqVIَ{x[tn4q1BہrX+NMzs<9ABi`i[Ě:2frMmֲ,8fYN&l̅;CTi4Z 7U2E 1TLup܃d9%㝩fνv hKI@ѵll0XG_}~,$ TNL Hس풔`8c]#SZp{R7Bn!TlMQkDq vRS{Xy]34㭅Z(e>:(~hw!dw#b< f/`"U  v7AըW^@̫=YGAr\})gnk#A/7sjg/ҿ7^M~h˴bI褉!b:Rb(RSmcUga,Kk,o/#C^9tф13c\b5)JKizL)$XؚXPo5ٞQ"˲"/A/,( G茾wGFR@#iuRM^7ۺ1HZ/v';V,~aArb͞B"]67ӚA8Zmہs8UbB[:i$+ YqVK|%B[a[elʂ!C +k-r5`J^Tַs%|^л++}Isb ˻|e P켚:Nڧss(tmElO?FҪ7jvȋ gsIܺX_eAZ 46rИ@ |dikՔP6UIiqƭ,4 f:EXN05a))wU5yZHa&?baN{X&p+C耫*re4cCir tGO!n\`~ַ%;HT+Vr,0YE_zlÉ;3I ^ٚ.-؂}88`{Z,% J(J,> Xo%e\J89@R^Er3'R[vNKxkR(B^eןq,W7p\,._-Qr.xȸGX=E4 XR+r^ A W(WXwQ荩N1__uaQE=/PK !X##word/media/image1.jpegJFIF,,"ExifMM*,Photoshop 3.08BIM,,mhttp://ns.adobe.com/xap/1.0/ image/jpeg BIOTA 200X80 2016-02-11T14:29:48+02:00 2016-02-11T12:29:49Z 2016-02-11T14:29:48+02:00 Adobe Illustrator CC 2014 (Macintosh) 256 184 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAuAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FX Yq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXY q7FXYq7FXYq7FXYq7FXMwUFmNANyT0AxVD3mo6fZWMl/eXMVvYwp6kt1K6pEqD9pnYhQMVU9J1jS dYsI9Q0q8hvrGavp3Nu6yIaGhHJSdweoxVGYq8+87fme2nX9xonl8WsupWSLLrGqahIYtM0yN/sG 6kX4nlk/YhQ8j12xViln+bWs29jP5gtPM2l+cNH0xkPmDT7ayl0+8t7d2CNcW4klkMqoWrutGHQ4 q68/NrWbixg8wXfmbS/J+j6mzny/p9zZS6heXFujFFuLgRyxmJXK12WijqcVZX5J/NBtR1C30TzA LSLUr2My6PqmnyGXTdTjT7ZtZG+JJY/24XPIdd8Veg4qg9W1jSdHsJNQ1W8hsbGGnqXNw6xoKmgH JiNyegxVUs9R0+9sY7+zuYrixmT1IrqJ1eJkP7SupKkYqiFYMAymoO4I6EYq7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq+evzz/ADSjvtRfyhp8rDRoHaPWZIKmW9uoxyGmw8fi CkjjKwHX4NqGqrBIovOWg+WLvQrvy5rNz5Iq9zC0tpKzJPKDGshWUAJFCrmVVZQDKi1pU4Ferf8A ON7i5t9Uv9OhMOhyxW6lghjhk1Ay3Es/ogqhIgimhgL8RXgOtMKs28+edJrGOXR9DnhXWjH6l7fT EfV9LtT9q8uifhqB/dxE1c/5IOKvM/NOg+RIvKEU8UU+qaf5Uk+veY9H1RLuyutSk1LgiXzuwhke Y8X9LkpU/Enw02VY/wCa/wAnL3ypY6xrOq6hHZeTdNE8cFpbSOby9tJZU+r2UjcaLzdUDSci1Ooo ooq15V/Jq782WWja3peoR3vk/URBFPa3LuL2ys4pW+sWMbUo/B2cLJyBoNhRjirIfK2heRJfKEs0 sU+l6f5qlN95c0fS0u72702XTeSSXyOomkSYck9XiAo+FPiruq9M8h+dJr6OLR9cnhbWhH6llfQk fV9UtR9m8tSPhqR/eRA1Q/5JGKsJ/wCckX+rW2l3+owtNocMNyoJT1IY9QElvLB6wCuQJ4oZoA/E 05npXFXlMsXnHXfLFpoVr5c1q28kfBdTGG0lVnuI1CGQLHs8UyoJWVVIErtToMCs7/Iz80ksdSXy hqErfoad1j0WSeolsrmQczps3KjcQTxibxHHuKFX0LirsVdirsVdirsVdirsVdirsVdirsVdirsV diqje3tnY2kt5ezx21pApeaeVgkaKOrMzUAGKpDb+b7zUU9bRdCvbu0IrFez+nZQyb/sLOy3BFNw 3pcT2OKsd8+fm3ceTrYyXumWk90wHoabFqHK7lYmlEhS3c8dxVjQfhVV6NirDfzf87f4N8ganrMT cb7iLbT9gT9Yn+FGoSK8N3p4Lir5utp/MPl/U7DSfKGnNN+YGrwC7ursxrdzafbzqZorSL16qkpj kEtxM/d+owK9QuPK/wCbmsaRa3/m+/Hl7UdDt7uca7Y3wjeSqBoI7i3hVbc8XHxt0K7U3wqkX5f6 h5k1G5g/Q19Ha2+sW1ze61Bb3I060a6smgS4uQfql1NE0sV3EXSIxASK/wAXTFWZea/JPnF/LC+X 9J0m0K3dxHcQanp17Nby215GyvHd3jXHJ7tQQWJLFqhdiaMFXfmXf+X/AC55qstZ1fyrf6v65txJ q5uhFpizQcvQLwvN9XWRGY8GmVQCahupxVilvrHm7zpqGj6Hrlwb+0TUZNXv7eS3W0ubBLJbwQW1 zGnwyRyPAhVvHZq1UlVhXkr8yvO+jeX7uz0J49P0fSpbbVdRuPSSd/QuktbeGxhWQU5u3Nq7Ft2B HcK9e/K/U/LnmnzFca/o3lXUdH4rcGPUpJXWxE85AnBtWeOL1mZAX9JGFQOTVwqu8q+SvOY8sN5e 1bSbMLZ3D3E+p6jeTTy3N5IzSSXdm9vwe1UlgykMGBLbdSVWGfmDqPmPTbmf9NX0dzbaPbW17osN xcjUbRbq9adLe6LfVLWWRoobSUokplBkZTy64qn9t5Y/NrR9Iu7/AMoXw8xajrlvazHXb6+EjRkI TPHb28ytbjk5+BugXYjbFXl1zP5h8wanf6T5v05ofzA0iA3drdiNbSbULeBRNLaS+hRXlEcZlt5k 7p1OBX0j+UHnb/GXkDTNZlblfcTbahsAfrEHwu1ATTns9PBsKsyxV5x5D/Nu485WolsdNtIbkA+v p0mocbuJgafFC9uh4mhowqPxoqyO4833mnJ62taFe2loBWW9g9O9hj3/AG1gZrgCm5b0uI7nFU+s r2zvrSK8sp47m0nUPDPEweN1PRlZagjFVbFXYq7FXYq7FXYq7FXYq7FVO5uIba3luJ2CQwo0krno qoKsT8gMVecXfmPQvOvnHy5YW1wLjQba2u9auoZFeLnc2kkEdvHNFIFcekbgy8HX+VsVea63q3nr zfod35r8xay3lPyfdScNGhZp0lkjLK0ax2dq0Utw7hGHJ5KEVZVC/EFWMfllL5ctdU8w32tr+48s tHc/UYrMQ3d/JHdEQQyfvJQvG7ZAUqS7LHyPwmoVPI/zJ/N7zZPe3ceqp5ctLWBr14qRwWlrbLOi LJJctFdTTlwJIyFQgONwKFSVST8yvM/5gaj5e0Cy85C0v9BM73Vt5mtgJLS7pC8YQmGiiRQz8SUR q/sbE4FereXob/yb5t84+ZdV061jj1jUjFYX97fwWjy2iKPSitUlHE8j2Z0rRfDCrA7/APKby75l 1W68yPqZiTVJpr2KTUIbh4Li0upjNC9vNG+0kcL+g0TfErrypSlVXo3kb8sIJtF1C3umuRY3Omz6 Ra3lxF9Xurj62Q15eNAwHpK7RxJFG614R/FXlirybzj5Kv8ATtM1aWdYI7u11i28t2UGmvcWdjE0 1ul01/MsksnFjHKsYFRGp7HbAqWeT9K/Mh5b648uyT22kaXa295qmn3l39dN7Y3cfriRbSVY4pla DfiUU/s15dFXodtLe6JBDqcdheOulxz2dpdWTQSwwxTK6T6dcSXc1uzW6SrHcWkh5MI2VabEEqwn yx5W80XWh2lnq2l/VdAjlSaRzOhTUrxVEFrbyTQEsLaEGSZ6fZj5AdEwKgvOGl/mPFLYXPmSSe40 fVba4u9KsLS7+omzsrSP1i7WsSyRQhYN+IRj+zXl1VTPyf5KvtS0zSJoEge8u9XufLd9BqT3F7Yy tBbvdLfwrHKnJhHE6EcjGx7DfFXrPnn8sIIdF0+3tWuTY22mwaRdXlvF9Yurf6oS1neLAoPqqjSS pLGi14SfDTjhV5zp/wCU3l7yzqlt5kTVDKmlyw3k0mnw3CQQWlrMJ5nuJpH3klhj9FYl+JnblSla Ks88ww3/AJy82+TvMuladayR6PqQiv7+yv4Lt4rR1PqxXSRDiOJ7K70q3jiryj8tfM/5gad5d1+y 8mC1sNBE63Vz5mugI7S0PpJGUBmqpkYKnIhHav7G4OBU7k/Mn83vKdxZ3cmqp5ktLuBb1IqRz2lz bNO6NJHcrFazQFAY4wGWhc7A1Cgqkf5nS+XLnVPL1/oi/uPMzSXP1CSzE93YSSXYE8UY9SINyu1c BKgoWk4mjCgVlGiar568o6JaeavLmtN5s8n2snDWoQ07SxxqS0iyWl00stu6K6jlHJsKMyldyVel WnmPQvJXnHzHYXNwLfQbm2tNatYY1eXhc3ck8dxHDFGGc+qbcS8EX+ZsVej21xDc28VxAweGZFki cdGVxVSPmDiqpirsVdirsVdirsVdiqncXFvbW8lzcyLDbwqZJppCFREUVZmY7AAdTiryPz1+Zvl2 7b6jq1xNZeVuInu4IoJJr3Ubep+1Gin6tZPTd5eLSgEKAvxFVi1j5omTzLa+f7iyuReXl5Jc3Wj2 9vJM1p5bntUtUnuzGGVHJtUmCk7gfDtiqcfmDo8Hnf8AOHQdJudSMHlXTvL8uttLbuEEiTStbycZ d1CtHw+IdFrSla4qkOp+TvyzHly885eQYtRs4dGeLUbiSX639R1OGxuVleMSXRPM846qQftDp4Ks Y17ybrV/Zz33k7Q7fzN5V1F5p7C+05YILpFuWLPbXyxoLl3h5kKOXGoVmBKgAK9P8h+WLDzF+S2p +VL1Fj1F0lE+lSIY7iyn4/6MZIWCvG7NEJelKkgE4VeQ6d5oh/MTV/JGn6ndMsttHaaRqMJDEtH6 7wzsJBXj9bimhRqgfEPtVADBWQa35nuBr6W8mjapr+o3k0i6Zpul391YQabaRO4toLSG0FGmFvD6 zlhQAjbrRVnp82tr/kTR/K+rzX6atqV0lrrkf1eZL2HTFvZIVmvSicbY3EUKB2cj7RI2wq8z8h+a 7nSNW8zeTfNFzpsttp8ZtLuDXOSWl4unyCCE+qqyukyJxVCEfmgXYFAWCp/o2q2Hl7zAmpWGgPJd +Y7K40nQLu3gltLCAxqHjWJbz/SZUqazTsiIqgBVoGwqwrzJFp/mTzTeiGebVlvm4+XNCt+bc5ob UW0N48SMAolFjGXLAVjcNXY0Cu8tx2HlvzVZCaebSVsSF8x6Fcc14TTWptp7xInJDCIX0hQqDSNG au4qqzXWdVsPMPmB9Sv9AeO78uWVvpOv3dxBLd2E5kUvIsq2f+kxJUVhnVHRlJDLQrhVIPPvmm61 fVvLHk7yvc6bDbahELW0g0Pk9paLqEhgmPqMsTPK68lc8E4IWFCXJAV6Z/i1tB8iaz5X0ea/bV9N untdDj+rzSXsumNexwtNZc1pcm3imcIUJ+yC22FWBaH5nuDr8ltHo2qaBqFnLGmp6Zql/dahBqNp K6C5gu4rsUSY283rIVFCAdtxUKx7UPNMf5eax5407TbljJcR3ekabEAwKx+ukMDeoaV+qQwTKtAf ib7VSQqr17z55YsPLv5K6b5TsVV9SWOIQaXGhluL2fjS5aOFVZpHVpTL0pUAEgYVeY6B5N1uxs4b 7zjodv5Z8rac8Nxf32oiCa6dbZgyW1isifWUefgAw5calmUAsVIVk+meTvyzPlyz85efotRvIdZe XUbeSL639R0yG+uWlSMyWpHA85KsSftHp4lU/wDy+0aDyP8AnDruk2+pGfypqPl6LW0muHDrGkMy 28fKXZSqx+p8R6rSpNK4qk195omfzLdef7eyuTeWd5Hc2uj3FvJC135bgtXtXntDIFV3BunmKg7A /FtirKfIv5m+XbRvqOk3E175W4me0glgkhvdOt6j7MbqPrNkldni5NECAwK/EFXrlvcW9zbx3NtI s1vMokhmjIZHRhVWVhsQR0OKqmKuxV2KuxV2KuxViOuhdc86WXlucctLsLUavqMB3WeRpjFZxSDo Yw0UshB6sq9q4q+ZtCu7bXvMdt5j81xPLoWoaok2u3JhlkCGWrW8LyKCvDmEj4Hiwj6Ky0bArOfN th+ZmpfmLrPlryzDOlqJhqGqywTmwEizoYrb1LpSW4xQQxrHGKgtyJUgEAqwa/0/zJo1n5m0TUA2 k6p5Xsjd6famQXUUmmag8cF9acySXgeSVJIuVWTcH4iTgVDahqH5gW8Fv5I1ibVPLnlssjtFcWze lbyh/VkZXt4JZ7iITAvGitTdRUceRVeyfl9pdtpzMn5d6Bdz3lwP9yXnXzELi3hmLEFpEgcrNOSe iqqL4thVM/Pnk/8ANO2hi8z6DrseqeYNMilRrH6lHbi4t5VIkhQxsWbifjRJGb4gCDXqq80sP+cR fMkem2epQeZIrXXFWOf6q1u6pDMKMFFwsjNVG/a9PAqGuPIH59eWfOkfmuDRbXVbqGcXBksnWRCT zEqqrNHOFlWaRePGgDbfZWiqpq/m/wA7S3PmS+/wf5l0jXtRu4L/AEqa0W5RI5YoIrcrclY19eJP RJReJB5EbdcVZLZx+Xp/zB1Dzhb+S/MWu6hdSiayt5tMFnawTLDHG0jzXEgDsSnKOq/ByO1aHCqf eYPJH5pfmPdQvriWXk3SEjeFordxfao8M3H1YjOoWJEkCgNwPswYYqzvyF+V/k7yNZmDQrILcSKF uNQmpJcy0/nkoKD/ACVAX2xV3n38r/J3nmzEGu2Qa4jUrb6hDSO5ir/JJQ1H+SwK+2KsD8v+R/zR /Li7mfQo7LzlpEkccIiuHFjqiww19KITsGidIwxC8z7KFGKpFeR+XoPzC0/zhP5M8xaFqFrKZr22 h0sXlrcTtFJGsiTW8pCMC/KSi/HxXatTirGtI84edYrjy3e/4O8yavr2m3dxf6tPdLcukkssEtuF ti0bCCJ/WBdeIA4gb9cCqdv5A/PrzN50k81z6La6VdTTm4El66xoCOAiVlVpJysSwxrx40IXf7TV VRN//wA4i+ZJNNvNSn8yRXWuMsk/1Vbd2SaY1YqbhpFart+16eKvS/Ifk781LiGXzPr2ux6X5g1O KJVsfqcdwLe3iUenC5kcMvI/G6RsvxE1NehVK/zC0q21Jgn5iaBdwXduP9xvnTy6Li4hh41Ku8CF poCD1VldfBsVeOafqP5g3ENz5I0eXVPMnloF2SKC2f0riZmMsbO9xBFPbxGYh5EZqbMKkNywKibD T/Mms2flnRNPDatqnmiyF3qFqJBaxR6Zp7yQWNpzBBSBJInkl40Z9gPiAOKs48o6f+Zmm/mJo3ln zPFPJbesdQ0mWeY34jFugiuSl01G4ywTSLJGaANxIUAipVg+vXdtoPmS58x+VInj0LT9UefQroQy xrIYviuIEdwF4cy8fABmMfUKtWwK+mdDC6H50vPLcA46Xf2h1fTYBssEizCK8iQdoy8sUgHYs3am FWXYq7FXYq7FXYq7FWC+aNRg8r+fdN8xX7elour2n6Fv7w7R29xHKZ7J5T0VHMsycjsGK1O+KsC/ 5yC8pW1j5d8uyadE1n5Vsb2UaulqtVhS/kTldMFDN8A9WjDfkw+RVSP8rfze8wareX0mpebNMtdW umjEUGqJSykiiiWNPSZJYWgl5VkZSSrlzxAZWoqx/U9OfXPM+otNrUfmO8833+n6GL61i9O14Q3E d5erbAtIWgtY4IAXB3Ld/tEK+s8KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV8maZp z6H5m05odaj8uXvlC/v9DN9dRCS1Ec1xLeWa3QDRlYLqOecBydivavIBWQfmn+b3mDSruyk03zZp l1q9qZBLBpaH6jHFLE0beqzyTPPLypIqg8U4DkCzLUqnn/OPnlK2v/LvmKTUYjeeVr+9iGkpdLRJ ksJH43ShgrfGPTqx35KfkFWe+V9Rg80efdS8xWDeroukWn6FsLwbx3FxJKJ714j0ZEMUKchsWDUO 2Ks6xV2KuxV2KuxV2KvnbzxeecvNp1m18wSz+WvL7Xb21iLv69aWTWcD0DzSxWrxcpiteU03AL9l P2sVY3Hb/nH5O0wfofzNpc+hceJt49Ss720KE04QpqRiZVI6Kr1PTvgVh2t2F9dQx3nnZbLy7plf WW2tNNsLPU7s0FRBDDGswVjX97M4jPWldiq9W/5x18vXHmHWm88XNmNP0LR4n0zynpi1ZIg1fXlD Nu70Yh5P23ZunGmFXvOoaFpl+/O5jcvSnJJZYjT/AJ5smKvj6+1TzFD+eo8sR67qg0ZvMMViLY31 yQLeS7VPTr6nKgRuPWuBX1tfeTtCvbU20iTxoV4h4Lq5gkHv6kcitX3rhV8+6b+bvm38uvzVu/JX mHUZ9e8ux3UdulxeHndwxXAWSKX1ac5CqSrzDVr+zTAr3/zF5Y0rULG9eX14ppIX/fW9xPA6niSG UxOlCDhV8r/8496nrnmf8x4NN1zWdTvLBbaeY27X10qs6ABeXGRTQcq9cCvqfWdT8u+SvLt9rN65 t9PtE9SZmd5HY1oiL6jElnY8VFepwq8s/KzzD5m/NvWNR8wavPLp/lHTJRb2GhWkrRJPMV5t9akT i8oRGUlSeJJ6UrVV6D5n/LuxvNJnXy47eXdbRS9jf6cxtgJgKr66R8UmRjswdTt74qwj8jfzxuvN d1N5V80Itt5qsw/CQDgtyItpAU6LKlKsBsRUgChxVL/z2s/Nus/mX5N8taBqt3pn6Tim+svazSxK scbhpJWEbKGKRhqV+WKp/wDml5XtPK/5Qa3Lpd7qAv7SGJ49SlvrqS55iaMFvUMm3LuFoPbFXnv/ ADi1d6j5nuvMkXmDUL3UkgitfQE93cEp6jS8ihEgKk8RuMCorz/5W8zeTfzZ8mT6ZruqS+Wdb1ez iNnNeXEqxSC5jEkDF3bmjo1V5e4OFX0hir53/P8A/Ni58u/mZ5Us7KVhDobrqGqRof7wXB9MxMPH 0A3/AAeKvoS3uIbm3iuIHEkMyLJFIOjKwqpHzBxVUxV87/8AORXl648va0vni2sxqGhaxEmmebNM aqpKFp6EpZd0eigJJ+w6r15UxV5Tolhe2sMl55IWy8xaXX1mt7vTLC71S0NDQXEM0bTcVNP3sLmM deuwCswmtvzk85aWf0x5n0u30LjxED6lZ2doEU04TJp3qsygDdWeo6dsVZL5GvPOflL9DWvl+afz NoC3aW18LT69dWS2c70Lwyy2qRcoS1eUM3Ar9pP2sKvonFXYq7FUv8w67Y6Bol7rN8W+q2MTSyKg 5O1NlRB3Z2IVR4nFXkXnrzr+bfl+DRdYu5raz/St4qHy5bQxSmG2RGlkE15O6h5qAL8AVa1p2xVP dU/5yN/La3t0GmT3Os6pORHbaVaWs4neViFEZ9VEVW5EAitfY4qgdd+ujQJPM35savNpWmyjjbeU NLnaFDzBKwSywlJrudh1VXCDfam4VeSXfmq8k1ddK8h+WotFaSPmINIth+lRCymj3GpTxMkK/FUt HyC/z98Cse0XyzZebvPlh5TbWxbw3chl1Kl5JdozxipUXEhEdzdOBx5RoE/lLYq+z9I0nT9H0u10 vToVt7GzjWG3hXoqKKD5+5wqi8VfEutzJD/zkuZnDFIvNEDsEVpHIW8QniiBmY+AUVOBX1tqn5ga FpthNe3FvqZigUswTS9QJ2+cAUfNiB74VfO2g/l3rP5ufmXd+d7mW1svL8l3FO0KXMNxdNBAESKI xwPJ6blI1DFyKdq4FfU2of7wXP8Axif/AIicKvjn/nFX/wAmvH/zA3P/ABrgV6H/AM5ia7cQ6R5e 0ONiILyae7uACRU2yokYPiP37H6BhVmP/OL1rFD+UVhIgo1zc3UsnuwlMf8AxGMYq9ZxV8PeaLub yv8A85B3t7aExta699ZCoeqTTCR07bMshUjAr69n8tyT/mLaeYpErBZaVNZwvVdpZ50c7V5VCR0r 03wqkn5+/wDkoPMv/MPH/wAn48VeQf8AOGv+9/mr/jFZ/wDEpsAV7n+YflifXrXQ2tohNc6Trmma moqqkRwXKidgWIHwwu7U6mm1TTCrJ7i4htreW4ncRwwo0ksh6KqirE/IDFXyz/zkV5Jmk8p6N58e EpqF9cSnVqgeosd5WWzR6f8ALPGoh+7Ar1b/AJxr83/4h/LGzt5n5XuiOdOmr1McYDQH5ekwX5qc KvVMVQmr6Tp+saXdaXqMK3FjeRtDcQt0ZGFD8vY4q+MNa8tWXlDz5f8AlRdc+sQ2col0wm8ktER3 FVX6xGTHbXSA8eUiFP5iuBWQ2nmu8j1ZtK8++WotaZI+Rg1i3H6VMSru9vqUESpMu1Q0nENt8ffF Xrehm8OgR+Zvyn1abVdNiHG58n6pO8yfAAWgilmLz2s6jopcodtqb4VR2l/85G/lrcwOmpXFzo2q wkx3GlXdtOZ1lVuJjHpo6seQoBWviBiqS+SPOX5s6/b6xrFpPbXraXdsv+G7iGKMzWzxrNGIb23d wk1GK0cMK/apvir1ry9rtjr+iWWs2Jb6rfRLLGrji612ZHHZkYFWHiMVSj8zNI1LVfJOo22mRC41 GIwXlpbNSkstlcR3SRb7fvDDx38cVSka1+XH5meXVtbq5VX5VmsJJjaahZ3AVkdWUMksbqCynswq N1OKsNmf8ifyjT9IrdjU9ctkZbC2M63l2nMbiNFokPIbGRgDTap6Yq83bWvMH5oecYXMok1ZkZoE jcHTtEsv25zNFN8c1KFiQtWovgAFT/TbW11wX2h+V455Py/8tSWVxr9zCrPeeYHa443Ejuo5zRCO KUhFry4jj1UAqwf85LDSL38yZ7zyVLFFapYQ6pI9vG0H1eS1UxngixiRSFiQ0UUBNTShoFfRf5G/ mZ/jrygs14Quu6aVttVi2BZqVjnC9llX/hgw7YVei4q+KdU/9adT/wACu2/6jUwK+1sKvkn/AJyN sbjyP+adh5l8sytpd1qNuLpnt6KPrMchWUlRsRIvHmpFG3rWpwK+kfKvmKTzJ+X2n67Kgim1DT1n mjH2RI0fxhfblWnthV8r/wDOKv8A5NeP/mBuf+NcCvSf+cwfLtxc+X9D16FC0emzy21yVFeK3QQo zewaHj82wqyj/nFu+iufyktIUILWV3dQSgGtGaT1qH/YyjFXrmKviPUdOm85/wDORF3ZWgMyXOuu ruO1vbS0kfbsIoiRgV9uYVYB+fv/AJKDzL/zDx/8n48VeQf84a/73+av+MVn/wASmwBX09hVjXnw T3mm2/l+1K/WNcmFq/qKWQWqAzXXqBSDweGNoq/zOuKpb588o+ZfNXk/VPL9zLYGO9hKx8YpgVlQ h4mBMlBR1U4q+df+cWfNUmhfmJP5fvCYoNbiaAxttxu7bk8fKvT4fUT5kYFfYOFXnX55fmZ/gXyg 01mQ2u6kWttKi2JVqVknK91iX/hio74q+efyftdBtfzCsrrzkIjELC41Np51e4F492AiepE8bScu Mz7EcWoCBX4mCsz1O0tdD+o6H5ojuIvIHmSS9uNAuJleO88vutxxt5EdhzhiMcsRKP8AZ5Hl0YEq x9da8w/lf5xndZRHq6orTpI4Gna3ZU/dziaWb4JqVIIDUaq+IIV6VDJ+RX5uJ+kGuxpet3KKt/ar OtnduUFAJEaqTcAaCRQTxNKjphVmJ1r8uPyz8uta2tyrPyrDYRzG71C8uCqoiqpZ5ZHYBVHZRQbK MVTb8s9I1LSvJOnW2pxC31GUz3l3bLSkUt7cSXTxbbfuzNx28MVZPiqQa/5B8k+YJfX1rQ7K/uKA fWJoUMtB0HqU509q4q8v1r/nFny9capNcaFq0uh6fcENNYx28c7rtQiC4dhLGppUrU4qletfkx+X el+Y/K/kTTRdxy620tzrd013NyuLSwRpAjxIyQ8pZG4ghBxUNTfFUfpmgfmj5as4/NvkiO01qDXb aJ7zy7ORElrFGXNmllR41CxQSCNlJqSCdyfhVec+edL/ADO8y/WdU81aJPYalqlxbaXEWiiWzt7Z WLwxxczJJzeZzVywArUkAYFZH+U/mYx+ePLusxqkQ1qOfyx5jSJTHE19p8ayWlyEIX4p4gg6bHlh V9DX2tRWc5ha0u5iADzgt5JU37clFK4q+VL/APL/APMmb85D5yj8rX36MXXU1JFIj9QwRXIlHw8/ tFF6VwK+p28x2wgMgs75nHSEWc/M/SU4/wDDYVeB+dvyv/ML82vzCj1LUNPfy15Xs40tYJLxomuW hRmd2WGNn/eOzH7RCgU3NMVezT3dp5e8vHQ9I0e/uYtPtfqlnbwQMwYRx8UAlcqpr3auKvnj8jPI X5heTPzAt9Y1nyzfLp5gmt5ZIlR2QyL8LcQ9SKrTbAr6ZvLXSPNWjX2k6lYzNp90no3MF1E8PJW3 qvKhqpFQR0NMKvLfy88j+bfym1+/soYJde8j6q4kS5tgHvLOVahWltxRpAy/C5iB6A0HTFWc+aPN +syaRNbeUdIvr3XblDHaPcWs1lbwM4oJ5pbxIFKpWvFaselO+KpF+TH5K2fkK3m1HUJl1DzRfKVu 70VKRoxDNFEW+I1YVZzu3tir0yaURQySlWcRqWKICzGgrRVG5PgMVeb/AJw3ep69+XuraHo2iale ahqEaRxL9XMSrSVHJdpSm3FT0rirzz/nHDyx5w8jahrZ8xeX9Qt4tRjtxBLHEsqgwtIWDBGLCvqC m2BXvq63G1lJdi0u6RsF9E27iViabqhFSN+uFXm1h5o883P5qNqmoeUdTt/LENhJYadJxieVJJZY 5ZJ5I1c0EnpBaLUgAeJxV6XPrMcNtDObW7cTgkRxwSM60/nUCq/Tir5P87flp+Yn/K077zT5R8t3 62gv01GyeVEjPrBllduPOvFpeRFabYFfVGieYH1GKAT6beWFzJGHlhuYWVY2pVkMgqhIPgd8Kvn7 82fMpk88eYtYkVZRoscPljy4kqmSJb7UI2ku7koA3xQRFx03PHFWOeRdM/M/y19V1Tytoc99qWmT 3OmSlY4ms57dmDzRylDHJzSZBRwaHjWpBwK9H1PQPzR8y2cnm3zvHaaLBoVtK9n5dgIlS6ikKG8S 9q8ilZYIzGqg1BIOxHxFUDon5M/l3qfmPzT5E1IXcsuimK50S5F3MWt7S/jWQpHEzNCGikWhJQ8l K13riqZ6L/ziz5et9UhuNd1aXXNPtyWhsZLeOB22oBPcIxlkUVqFqMVeoaB5B8k+X5fX0XQ7KwuK EfWIYUEtD1HqU509q4qn+KuxVivmr8zvKXlm/i02/nmn1WWMzLp1lBLdXAiHWRkiVuC+7UxVNvLX mfQ/M2jw6vol0t3YTkhJQGUhlNGVkcKysD1BGKvE/wA9BcWH5oaFqst3Jp1tJp8UVjqcdAbW7ivg rTMzK6CP07sCTkKMvwnrTFUq0D8xvzH8teXns1uNPktmaeSBruCUSWbsUd7f4JBGwjkuCo5Gi8JK nihoqxXSfMH5p+fLTUfKlmbvzFYXN3FeXd5c8I5LYxSlpYY2mMKhWLR1SvwD4V23wKmb6BqHlWW1 iikgutVXzrpsq2wm9KESW9m81zEbl1OwFxGssnE79eRG6r3qD8yba3j9TzBptxo9tUA6mGivdP3F atc2rSekv+VMiDCrL4ZoZ4kmhdZYZFDRyIQyspFQVI2IOKr8VdirsVdirsVSnzb5n0zyt5cv9f1N itlYR+pIFpyZiQqItaDk7sFHucVWeTteu9f8uWmrXdgdMubgyiSxaQTcDFK8VRIoUMGCcgadDiqc 4q7FXYqhNW1Sx0nS7vVL+UQ2VjC9xcynfjHGpZjQddh0xVJvIPnCTzboP6XbT206N5StvC8gkZoi iOjsQqhWo9GXfiwIqcVZJirsVWTzwwQvPPIsUMSl5JXIVVVRUszHYADFWIT/AJlW1xH6nl/TLjWL atBqZaKy087dVubpo/VX/KhRxirwUaDqPmqS6ilkgtdVbzrqUrWxm9SAyXFmkttELlFGxFvIsUnE VPTiTsqlmra/+aXkOz07ypem78uWFtdy3lneWwSSS5M0qtFDK0TTKVUrIQlTzHwsOO4Csq138xfz G8zeX0s3udPjtlaCSd7S3laS8dC8iW/xSGNRJJbhTxNG5x0PFxUqmv5FfWL/APM/XNUju5NRt4tP liv9UkoTd3ct9xWZWVUQx+naERhRRV+HtQKvbPM3mjQvLGkS6vrl0tnYQkK0rBmJZjRVREDMzHwA xVKPKn5neUvM9/LplhPNBqsMYmbTr2CW1uDEekipKq8l91xVleKuxV8veZ9Tv7Xy/c30VzJZ6j5o S91vXtRgNLl4BK8Gm2EUgKuIkSMu6qwJVGUbtuqp/lj+Zd7+WVxN5c13SUNtfXyXWpzQXBL6e1zH FEkcqMnF5eKh3CycuvdSMVey+eX8teavL8t5pNxZa/NoEv1m5sreWK6EsAUrd2rqjHeWAtxDfthT 1GKvMfOPlD8ifLt3bx6n5o1rTLHVLZL62sYWlubaaB2Yp6Uv1e4KnduslQrHpzNVUq1L8yPJGgaB bz+XJrjR9KnnisrPStLuIE1NrCCG4klup2cXJhNxdTR/bIkKICKb4FYx5m8n+c/N1/6UGkmLRdB0 w36adYzLO9qbwG543VxctH6l3MCsstOTEUoMVY/pDazbaxpSwXM2nXtzbySaVf2o+ryOnotLDDPG nBSGkYH4qllI24MpxV6x5J/MrWvK3lKDzKtiLvSZpBFrej27rHFDJLO8EWo2OxWOKeaGSOWLZfUH JaBsKq3m3/nKeaQ2VnoOi3di00sMl5dXIjaUWwKySCCJTIrFo/2idvCu4VfQWl6pp2q6db6jp1wl 1Y3SCS3uIzVXU9CDir59/ObTNYn13Udf8y2tlrnlG3aKDQ9PGpyWjMVosscEMALSXJkLV5VpTpiq XfmLol/a3k+hahZatb+TtLW2sfKnlvSQYob2W4QENPdyFlkkMhbkiq79TQbsyr1O11m5/Lr8u/LG japNarrtx6en2/1y5K2sTUaRmmnkJPCCIU+HYmirxBFFXnXm3zh5l/MPyR5d0dzb2epax5naygu7 Pktvc2djUm8hjlZ39NXZTux3X3pirKvMH5uDy9dwaB5UXTrm10fULTQG06WRnv7mQhVlW2iiZeCw hgpkcEF+S023VSfz7/zkXr2keY9X0/QdNtr7TtGv7W1uLxubF/UT97AvFxWZpFkCU6BGqD2VV/KP 58eaLga+/mWzsLB49Sh0rRIZJfQiS6l5+rFcTszArbIqtKyjqaD7SjFUV/yvvUbTyPd63fR2Nxdx 68NH0+4tFm+q3sCOjS3EEbuZGAi5gEORyp8sVeRawmp6rpXmuwl0p9Pv01DT9O0yIajqExSe9lJa 0l9e5lhlcIlH+H4TX2wK9XvodM8oeYvJvlDTRJKz3EcPmLVZL2+SKOaWNpwqiOdEWa4KvLQjpSo+ LCr2W+1rSbHSZNYu7uKHS4YvrD3pYel6VKhwwqCCDtTr2xV4B5T/AOcpp4ze2WvaLeXzwzTSWl1b CNJTbktJGJ4m9NVKx/tA7+Fdyqo+dvzK1rzT5Sn8ytYi00mGQxaJo9w6yRTSRTpBLqN9sFkigmmj jii3X1DyaoXFXk+qHWLnWtUjubua/u7a2jfVdQugbqVEECyzRQRvyUBZEJ+GhVR2RXOBWQ+W/J/n LyjfmGXSml0TXtMF+2n30ywPdGyUXPG1ntmk9O7ho0sVaMBWoxVk+m/mP5G1/wAvzz+YprnV9Lgm ls73StUuIH1NbCeK3kiuoGRbYzG3uYZB8BMgRyTXbFU18neUPyJ8w3lxHpnmnWdUsdLtnvbiymaW 2toYEZefqy/V7dm6L+3Uqo68BQq9N8jP5a8q+X4rzVriy0CbX5frNtZXEsVqIoCoW0tUV2G8UAXk F/bLHqcVeM/mh+ZV7+Z08XlvQtJUW1leyXWmTTXBV9Qa2jliZIkVAqS0YugaTl02JYDFVXyxqd/d eX7a+luZLzUfK6WWt6DqM5rcpAZUg1KwlkJZzE6SB0VmJCuqnddlX1DirsVfKf5pCXy55hj0iYKZ dNt5ZdPSQmL6zZx6kNQgSJiGjeiOYihoeUVV34q6qTeV9O8ua7+a7Xdy0eox3V5q+p/UZX5pccYX u7FpIWAJ5K9aAsCBQgHkGCpl+TOi+atR81apq2iavHZfoqyFxqdy1pHcy3El8pkEBUekzKfSNA3H hQALX4iqm2i6RrH5nflz5UsdElt7STypbSLe6tfKVi9Y/uY7NDRmp6K8pGpxHw9egKsZsfyx1m+8 1x2rnStSiknEc0uktK1vcToSzWvqSRpWOP7dy45cVAHL1OCEK+ptJ8p2mmeWp9HikLS3iTNfXrAc 5rm4B9WdwO7E7DoBRRsBhV826j+T/nu0fyzpUOmSDV7W4dxqj3dn6D+gPU/0GP4WDsKys06ciVHU LgVl3m7SvL3lW28q+SdXuIrKLzHY6rp2oMhDxWzXc0dzavVgtUtrk+nGzAfDXphVUk/KnQNM8uQa RBoJ8v8AmmWe3jsdfnlF7ZTXcbeqsSTCV54obgoy0MSfa3B2qqxj8v8AWfNHkT8wJvJXmzTZNJ0T zbPcRRxxykwJLdNxhktJFqopzEbFSDupYArgV675V/5x/wDy38ualBqUFrPfXdoQbN7+YzrCQeQM cdFQENuCRsdxhVl03lPTLjzRD5kumlub20hMFhDKwNvbc6+pJDGAKSyD4WckmmwoK4qlP5ifl5D5 xg05k1GXStS0mc3FjfQokvHmnCRHjk+FldeoP6tsVSqX8mdPksbNm1q//wAQWdxHdR+YKxNOpjR4 xFFEyNBFCFlbiiJsd9z1VS7TvyCstM1S4fTvMepWujXbia606Mp67yFAkjfXSDOvq0+PgQT44qi9 A/IXyho8lk6ySzrY6rNrKQsI1ieZ04QI6hfs243joRvU96Yqlkn/ADjlof1OX0Navo9VF82oWWpP 6cht2csZI1iICMsnqfvK7tRa7LTFUzt/yO0dtT0PVNV1W71W+0a4N0zXAjEUrAfukSFFEcEcT/GF jG5J5V2oqpn8g/Lb/p2SbULyS51i8k1C2nLJWynknW4MkA40Ll4kDM1SVUL44qiV/JewmvIptW1u /wBXtmvF1TUbK6Ft6d1fonpJK5SJHVFjonpKwSgAp1qq8y/NfXvNPn/8xf8AB3liwbU9L8tXEDXt pX07aa4Vw0rXUh+ARRhTEEO5bkRXpiqap+VOgan5dn0ifQTr/mmKa4jvtfglFlYw3cjeq0LzGVJ5 YbYuq0ET9NgDWiql5S0ny75rtfNXkjSbiK9i8u2Oladp7OQkVw1pNJc3UlVD0S5uRwkZQfhod8VY lp35Qee7t/M2kzaW51e7uEc6qt3Z+gnrj1P9OjPJi42lVoE5gseitQhX0lq3lO01Py1Bo8shWWzS FrG9UDnDc24HpToD3UjcdCKqdicKvlm+/LHWbHzXJaodK02KOcxwy6s0q29vO5DLa+pHG9I5Pt2z njyUkcvU5oArJdZ0fV/yv/LjzVYazJb3L+arWNLDVbFSYfVH7mSzbZWAEDco2pxPxDboSqU/nNo3 mnTfNOmatrmrx3v6Vsjc6bdC1jtZLaSxUSGEKfVZVHq7gcudSCtfiAVLvNOneXNC/NZbu1aPT47W 70jU/qEUnBLflCl3fNHCqkjiqVpVQAaAE8Qqqc/lcZvMnmCTRoFUSajBFLqCp+8+r2cmo/pCdJGA CJ8KLEqbnlLybcsqlX1ZirsVY158/Lzy1530pbDWoOTQkvZ3aBfWgkIpyQsGUg91YFT3GKvnLW/+ cc/zW8r61Hqvk+eHUI7Sdbmy+rSC3ljZOhMNy5Tuaj1GqNvbAqh+X8H56+SfNs+pWvlC7ubW8VYL nS2VhB6SnlGkMtXEfp8iE6gAkHFXolt+WkHmTUP0rN+Vlhod9KfUkudS1F3gDNuW+oWnwyGp+y4j r4jCr1Tyt5Ns9DLXMkv1vU5IxA1z6awxRQqarb2tunwQQgj7C7nqxY74qyHFUs8xeW9K8wWC2eop JxjkWe3mgkeCeGZAQssMsZV0cBiKg9CR0xV5t+ZX5I6Pf+S9WfSoZr/zQDHeW19qE0l5cSvakssH OctRGRmQIKLUiuKsL/LTT/J2pLZ63b+YP0Dq1lAJE0XWX+t21m1OJutOWeaNQnUAtzMZqpoRirfl ltT83eZPOPleLVJNds7uEX/lrX9RKsonsZ7ZbhojEo4RPMU4+mnGiCmKs10v8/8ATLbzhdeTvN9p HpOrWkiRPf2sxudPLuFI5SMkLxVMgX4loD1IxV6l+kdP+tRWn1mL61PG08FvzX1HiUgNIq1qVBYV I8cVVpZY4o2lldY40BZ3YgKANyST0GKvPbz8+PIKao+l6U175hvY1Z5Y9GtZLwKqfabmtFZRUVZS RiqJsfzv/LS4cw3WrDSLxBWSz1WKSxlWteonVVPTsTiqpdfnT+W8TCK01ddWum+xa6XHLfSt/sbd ZKfSRiqBg/PryEuqrpWs/X/Ll7IFaNNZtJbMFWJCsWYFUUlT8TkD3xV6FBPBcQpPBIssMqh45UIZ WU7gqw2IOKqR1LTxetYG6iF8kQuHtS6+qIWLKJCleXAsjDlSmxxV5dr3/OQGlHzbD5O8n2a6/rs8 jQes8621kkigll9YhzIV4n7Ip2BJ2xVg+vtrflXzH5X0K/1U6CgebV/NOt6ay09fVLq7+qmRpU/e QwvyRvUTjRt/ZVd+ZWn+TtNW81u41/8AT+rXkBkfRNHf6pa3jUCi61JYJpAY+gJXgZDRRUnFWZ/l r+SOj2HkvSX1WGaw80EyXlzfafNJZ3ET3RDNBzgK1RUVUKGq1Bpir0ny75b0ry/YNZ6cknGSRp7i aeR555pnADSzSyFndyFAqT0AHTFUzxVj/mjydZ64Rcxy/U9TSMwC59NZo5YGNWt7q3f93cQkmvBt wd1KnfFXlN1+Wdv5c1H9Kw/lZY65fQt6kdxpupOluWXo31C7+GM1H2UElPE4q88/MGD89fO3m231 K78n3dva2StBa6WFYwekx5SJLLVBJ6vEB+gIAAwKr6J/zjn+a3mjWpNV84Tw6fHdztc3v1mQXEsj P1IhtnCdhQeotBt7Yq+jfIf5eeWvJGlNYaLBxaYh7y7cL608gFOTlQqgDsqgKOwwqyXFXYq7FXYq 7FXYq7FXYq7FXYq8a/Mv8l7K+lubuy006jpd7K1ze6ZAyRXltcv9u606ST92TJ1lgk+FzuKNirC/ JnlPWvJ+q3uoaH5mshdXNq1lAut6fe2t7ArOjyUtAv7119JBWrDYdsVZR5F/KYT299DOLuW11li/ mTzDqEbWt5qKM3qta2ls/wC9treR2JleTi7dANwyqs3ufyc8nwBLryzbr5Y1qB/VtdW05FEimhDI 6OGSSJg1GRhQ4qxr8x/yh84+ZPKF/Dc+aLvWtYVEewsOMOn6e7xurMrwxU5F1UhTJIeJOKvFNJuP N/lPz/pL2GmRaZ5h07hZy6LcupNxDdSwwIGkjNGWT60hXjUKwegCoqAKiPzJ/MXzN+YU1glxpUVg qI1tpGkRzG4uJ7rUI1USggwfD6ciFNiKP0Yciirf5bfmL5n/AC+kvkt9Jiv0KLbavpMkzQTwXWnx uplJYz0HpxuX2AonRfhLqobV5/N/mvz/AKs9/pcWp+YdSD2cOi2zqDBDazTQOFkkNFWM2rli1AzF Kgq7IVXsP5e/kv548teWLAaf5uudB1eRWk1LTTFFqOnq7uzBY4ZCvFghCsyvuRhVlNt+S/lm9W4u vOR/xZrd2yNPqd5GsRVYxRIreOIgQxCpPFTuTvXFWF+dvyggs7axgtI7m3tNHlM3lzzBpsJubvTq yGb6td20Y9W5gWX4o5E5Ov7Q6syrGvOXlPW/OGqWWoa75lsvrdvapZXCaHp97dXs6q7vHW1KfunP quOVVG57YqzT8tPyWsrCS2u73TTp2l2Uq3Fjplw6TXtzcJ/d3WoyJ+7rH1igj+FDuatir2XFXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FWM+c/y38n+cVt212x9W5tDW0v YneG4iNa/DLGVald6Hau+KoDyh+TnkHypfLqGmWDSahGnpwXd3K9xJClCOMPqEiMbn7IB3xV3m/8 nPIPmu+bUNTsGj1CRPTnu7SV7eSZKAcZvTIEg2H2gTtiqP8AJv5ceUPJwuG0Oy9K6vDyu72Z3muJ STX45ZCzUrvQbV3xVk2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Kux V2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV 2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV//Z xmp.iid:5bf734c7-c8a9-4792-9d22-847709338468 xmp.did:5bf734c7-c8a9-4792-9d22-847709338468 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:315d7ef5-91a2-8940-b8df-100bb07a59d7 xmp.did:0e41945b-be67-4e93-8645-4e215a459a2c uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:0e41945b-be67-4e93-8645-4e215a459a2c 2016-01-05T16:11:11+02:00 Adobe Illustrator CC 2014 (Macintosh) / saved xmp.iid:5bf734c7-c8a9-4792-9d22-847709338468 2016-02-11T14:29:48+02:00 Adobe Illustrator CC 2014 (Macintosh) / Print Adobe PDF library 11.00 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$*>u*xF {qB1m Ww⧊5kֽ] Yu J/&#nI@ Q..muPM"BFB6F<_|c<5ah6+.DX ?pqݢ?e~&F> <;v9vp nqqw({5;{}_֛Ձe;ew=?1?PEh%m¶;gkd9k GeQOkΊq|v.S℁—L%O:`x>+XO/6И/5km^6ngǭ94P%=pm0i^,FU(N: SC4kM.`uʺC޿Z%xMk]ğU.Hѯ0r}-vW_ ºO&5Q&F4h)B5_Ls`, 9ۏ3  ?D~]hDxsSam9szȀ7f>((((((|yeuȶT'pf~N:7;9{J~f@7bikٶlW]V,rp2O'KK)6W31ڿ(LlI z(9鷎P4-18D[L;d}>嵏WG~_\RmkS<@ɍ|>*? "x/;D hQ!d0fZ펥Z}V~І InH\r8kORoB*HV`E~@xWgew[[DyOPdDuT 7Qút{-##<OEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEf 4zLN(<7*.TkV8&1\Jo@о?P/ \^:ZFG!TRk I1ռ3:D-7)KmAA!F0f\OZ7N|Vڗ^bp&<5aD>S3mdIO?l(o(Zx6/8L҈ߏ&0~0bstQ@Q@gx˪&`ӟ$}J۩;io1cY}⿇ tۈInof5*vp(;7-@W{ ]|ltB-to;'!sܮ o4C?4t?&䁋s3c >Q(tW'csy?23نf##b߲/tK^fğKr2Eݜ@ʥ |u#4]BOo:~_vOnlat۸}:s#c)&L:BQ_50 િCz.hh?$}d2ҴQEQEQExg{v4:7>a_WDem.<*(,(&=?O x vuj7 omiYI~\g3j`Gӓt7^;ly:yl(K J ckL|F.1}|l4g$.Nv/>^%[*!R׾2xV[^6/o-B.5;Ai,&OHE鴓QEQ]jzvˬ .g8of$vT_\$7Oqm;2livāȋ7įMOc,-[q'PΊoS|VuIi5~P|NHO5 &Hs `'5%fIzq99$!dZ~Y(`?l߱gĿ ~"xnŅXoq<  clѲ"~y6⹴ ~¸O ۼ'%FvxL'E_|!C7me_Io:&࿈ * D?.$VpD32iq@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@s?3xS}o /q}j30['=Hq^3!|)^5pu ᑴٺJDiB7 `*T$O%_au4+]A\(RPJ|EP߱' 'Z=#ĚB*_XukMe&dG(8e!µ\K?)?ޛ - [?ho&hf?y$ ?S)j}f:d"kzx~F ǜ-˂N? + z:ׅYaEXgYNUAVOs1V/j6>I_\m K{( 3k>"_4:f++ r{]Zۡ#tz؅V#J> NhK/giAhB9d`g?+4wH1+Wuା$~՚3ᗃ{hv*y9\tQEWE~"Ҵ} GԵ%m-ޡ+0$j8%BlA= -g?z 7 ;h6x}!8!Ai $\ht~'yS!'I"*y&㿍g?^΋}ºB6:lcO!~ƿM?#Ҿ;[Ϩ>~{ftg m{QEQEQES]U`(?3Q.ַxnפ#>$۴HBIڹ+ jOaoy*3qW o અ8hO|xgL;pP<8k_?'g742Z||yЉa|1~S?_|U}qê|EoY!״݁X.N^WAq;+MLWaẳrdr2;s.Z??tOo^LOO -#o3_v @?P@Y7~?l/_>xKg唻0Hz92%T?Kk⏆:Hγ^yZaO "ԯ p?Շ + o+v4in%}0mi#3}T:@TQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE $@[O|b֠2i~ 5Ⱥu9,rd( _'ŚKվ'|Eɭ">w/tTY(0>'qyo79_')Վ Rc,0'j* dWEQ_?E6g?PAL S|0[fe%p'D~glm?wx.g t9 hO 9Hǖv<'(((((((7d~ۿuχtox__,N6m 'N̍W^A Efb*M~2kT[c:#(X5X@$lч@HF|k__?G`>3o|h5>|7Qg\̧'|Q~(g=t_xN"Gg+)du=HU8 rQA}_?w}+;_GqE㫈~` NG~_>~X|ɭxwimgnpݹBr6cH%?6Mu,ז 7EHz(˻OOLLoL='Ե)µxTpl`E +( ( ( ( ( ( ( (>5 U<5<*z<(Sc,O2 >5|bQxm|}ۧMŚT .J#LT)0?|p\/~V=/Ğ-Mm&#=Aڏ-~cX;.v-֫eJ<: ^?5ͺĀLzƟtx'|Yηzv B +QԌhc? S"I/ㅽ*ڻ,|Y0Zk-ljNߓnB'q-BUү.cO+K[dr,lu*0lJ_oaTY>?k:^+YxRI~T|`xY@ي( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ?Xb3R)OT}hx6'v?+ޜG6O8%c=b>NC|J!!˕Zh/|Y]jԗ7.RIu/ﯥwf|'9fzź]jơ4WwwW5Y.Yb'͢+yŚծZu}rkV~^QQ qET3Q>|M<"\ֵɢMy+ @8͂v p:_ďo>8\E֞ ޅZfI>U9X>}6 '1~=mޅ+i] sj dC.rOܨ!KXR8c5 j`*J(((I8aKTP2I'_ r0L>MZtIVG2F (e?@wQ_'INV~_q#R-ԚDQ1DđGnIc''bi5/_..  bt,/hH$`fIȨaCyjK~ ީ~g~?yRm> K迴GMB\[3_G6K7gPPQ_}& ďxN<˛EC+Jk'eoIԼQs7xQG$ ީ6Hc43EEe}e Ŵ[ )b`*0e# :ԴQEQEWg M=2_ȏjzI>9cm+y=#y~o<#zY[Z>i-+%CC@'8m/ Y-<+ȺcK=ZMGXdxJ .nY=s$zg<:-.zsc|`-_?_oسIBKxMMI(lmm%A#$@?nsχg*$fw)~am 4V12L'sm1W[{ gV6[fŬo CG!A7'c_hoٟտk?' -lYƏ䙤 Ґ 1V$q@gEέPxfShxBrURqWx+hO |>𽨳tmOPƨ ǩbIa@Q@Q@Se`vTD(I4+۷@ai &]b]FHdfܶVx!#Ҿ/x/ÿKS'}6~q J0vl !I250OǼ]S׎,ah&-۱SSil6y'gWK2V|>4]\%I|s$_ǰ$ 2>c 5~kzrʸ\]!'')fo=ZÏfT}it}ISAf 0J,`H=b9M ItK!}paղp@2G@ҵ{]{MHSee EPEP_]6KC >,|Ӵ T|jKh@0mw #*c!?2>ZI~ּ?+A Z8FGE Hp  Woxپ٤ۈ|^%Z_e=`&2d42ZEq+ ϑ!,BfGbp?QJƲ#+rk&.}7I?. h,v+˕,Y@ yD!.>-x>&vv`rIE\ I+|s߇?牼ckmggl$DU˼@@I?ևy$yx,|IĖѭ "e`7'(~I?o_-g#FAu+ca2e`OUQ(((('/Cgv?auY!R䆔@lܶ1ܬ0+LOy U􈴝7u}i-$[SQ{uh#Լ!?[uk\v_Z_Y\53 UM܂6?+;+?Yo4/W+/x*- *p+~EPEP>bHޫ6HČC6F_QEW_X"ÿ+_-Hm|?3C<3-(]lNY Bf@')|;|?6S6 9easz?௟H?V;%D񶈒Mo{v HGkAj ~%i2xo^em@LwV  VWE(?o6~|u"_C/& lnU<̣2W/j3YQRe@2O!@! X:p==#b]Ig>؈ y%$Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@W?R-%~4^9%:D.(|l>*(g OncC4ʟxL&u٥ ĒS_Ϗ8IכÛ7tʰwXYnGU+vK=ǒ|kk> xV"jɫGk$%UϳH;?߰-ϧ~(_/i>1 e7a9"(Rh-K0dd2AjZ.a-խa}vkW+s7x% <D?oq壅I$ $~_nj?l>9Vx'5sZː#vX \m_}'  ce2?w/3m8樯{7;a|[K=J<`ž.ݤ;]+ n;ٿWrC>柿*y ef3B8 9p@E~utfW&U{i1,ؼVkr6?V̈́7VwZ )IFC+=r(z( ( ( ( ('#(|'Oh~^r DZGr9feQ[< |־ |H<+e$V(e啰Bƀ)>'@%<V[xٌVZ׈ӹ6>Ll:[BX[3^Ꚃw~OG1%Oȝ%pCL n ( (? n_]yQdpH$c s ̢{/t]?I .~-i~`99ڼqq hi+Yn[y{k&1)$@0 AバA]k %Ӛ#E67jnH]? 0;*X[[q{π?[-^|<&/-+{| G! C?=|W:_<3i l~ܥŭ.2G"t "C/7?-|'.CL60-yb[+a-RO*8>~GC?x[Vٸaё"0*2@ 쨢((((((((((((((((+.7g?I0Zdš v +\cqdl #e?*/?KهP[BvU˛[adkHFGv*w~_nO!'4d ̐XBp"d,c' o&9x"K %*`frI$Y~ VZW|3j^ /Nӭ"3\O3h6FŒm( Ğ*M?^{P!Сl1c!|k" -n M|Pԡ׾3x3Mt1l 6 F +(fPEP\_DTSx'WGPZ8%$Q{xTPYx#R~-> |BZmKPmG\@,#_oVPVOUk5|?bOx[Ovm+D qZMҰ,r@>j?|<&Xur" I$M*7r2ާhm\$bNI9pK S ( ( (?H]hд.7û.<_Pg 1m2TT#a[ k Ao #ֹ5#N!׹l$x#s! ~~f¿5_kFTy]SH)s.9Æ "|=?>xn>rCM3w$p>߁d>4xԸ9I! >wJ8H{V@mC 8%w\3[bt/hVMKCˆG)j>"A/5 x¿ kJ 4!Nߒ, w˿~0~(~*5Oxxdw*>MPEP_@u57w~#Zo-2PD 0Fʲ@Q@~Wgծ-H 昿yk4m#F9df9 V~)|vM<RGPq;A=((45jhc6&,SnAkCmͥV!&#ʽG0(+,BT~ǎ+:TB!*>L@0r |"{^Bݾ2οC_Y8#Q260dKkWZu%˽Ԓ]Kxwvwsٟ;IYş 3Txw^jĄ\_Hn,F0 cW#@Q@[;??ڬmxG~ y˿-BEfkyyA|r71/c__oǟ'F]&½u j ]B0tlO]|]|3./jy^M$̡:IIvKүq _IIh+,ʂls :_ŏ e=tqmv!crq<gVci%G@[5v PĢKAS'iZǂ<}3>ס0^"va]N]He` eE~v[7bɯ<=ƚ2t뒣pL_ޢ;,ʀ ( ( Q>`k'$Ծ(!e> { O/!U]Eu߲O5wxoP2۶٬-6W#(AOW|Rl|\N}2G75pż˲0?$Ww?@aVVK5hϵf ,GPQZ (A!<mmx[tَ \|ZUDW2)Wq p~FѮ_hta NvMee$á- [e'k}o`-//w͆6o#(>d?2)f?~ n ʄ*T sї!! np?k aZ.yk5\^H˧H9cy :pA$E[o[G|!_K@ڥ~!\(-=rTK ٗ!X|YkBECCX` _F/+߳L:> yZb>7 \{YJHdoN@>Ţ(((((((((((((((((ھg&PE;@N~  <ĺKCPCoi ǀ x AmS{Clb\?^/[}Lv|@[h/V쿒[j Auс:LjFkkZ|G>wK-up7Ii $Vxclp Cg|qhpM#D-(4e ЦVLp1NrB<_oyq&ⶥL2LO=0xnEs?ě د"xn!&Q%to  0T#@?+W Ú7Οgn6!QFH ʫ`HHZ(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( s|~qa|h=7RPAXj4G@2ཿ])>`f]3^h?QG ʀ~Uq<eZϋ*A]U) JQ@Q@Q@3w7Z_l?τ  VNcYFS jk ![K+ƠGh]YE3[;Xr{p&:fxPOkڬڦ+5B̒yb#B-$AQ ssL?6X1# |ŹAFN&Exw@>/hBz ܖvNto,s R$۹??Y<|d$-A۱/ZKOmy@ vȉ7_QeK*G.BڟئS {??_jP2ƶ ( L.?8_*/g+XKIXvӬFt \z)`ui6M"qMJq/ps+޿_? 77}Mp[SS`=m999~AI Xk}yZ56So /47|ms$g7 :w#pL21!|2ooя2<'.xqo[1f E0R20R85I~ξx4o ͭ.~3VH+UH@~"U|xm7ŗW]tq&(]PPvl(T ix _w#FJѯ HŠ\\PNDg _txR4=r; Y"IU*AZ֯w =ŖmQc޼wt,`ā%^1"8BDTQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWׁa_~"jd y);xM#|98|I:<=g%"5,;k"e*!$zM[72xkMI|fPLH ڧG#R9Ӛ/|*-9C ö+7;̎@."袀 4 ~ڥY[IH͵Q~fvl K32Lo H={Ϣ n+nW u %xI };@=3 :i>&|nURUu3[F7 %N/O((G_>$?g=oI- .ury1[FJ% !T3O(&챯R}M_t$}Zp|HG舮5r~޷?%엚ψ% oZ?g&p s;0vb;<}y|n־"Jn5҆I[]&-cJ8TKבEQEQEQEv ~-{ Vto2YB8w=BO_ 2c |/pucu5\IRgby[@~hڿ?J?:k^m|;$[RGSmnjWiV |8`~:?zohoܭ 6sƹc+^<=5Ծ&x$$t : ͏ď#?rk&%_\ ..e rxI.P>(x CT#N-b yVp1\ŀcߴ2R_3\H6Cۡ/%1mm.W'Ɨ?p%_J${u[vq KypUA$ffo(~-?f߁kZ[O)dPJ<1i5Ġt48pykUC? ogVzk[9\ 7)ڠ~Q_M?>:gہ6\c" hr "Ys_X u:_9tѴ;ƎSp.,~=.8_-L0i~4o8Ğ`P 4*ۂJN($WKV`۞bh[Ɵ{t\,.d OĿi"o]^Q`m]ʂHSVR> @OuAnMr>ŸilD2bxU0`׊(?'?os|B񍅑_i=w#~ + =fٟgw(ԭ'mkJ(k#H@^' ;`?K7>j%𭐒F E:[p?&^kj> xó2GyQC"d]Æ r8m/υ:[Vm(3XN>hn']OU`~˞"i|'tpïxP6SK[UcʽI~&?;ukI4_}ך <3ۻ+yr YG٤.<≒7m5ϴl ;V?( ( ( /OGk?IW)n8xFFVG Cמ@W +_gxl|7v|C&F^ݘ-Q*ewƟ'ƟH{^h1^q`H22&t'3d ?O ?+앧xC-+Ě{.&~,A ~ppSEWo*klIG,tA[LrctNrVpBO|*/ish~& tJ-nQYd\~a3}_0 oyCnomfa`rpjE\E#pp {=jJmdw+}c/ma#+n8)vn=h _ÍXZ< i1Up1\I+DŽ@' )ãL {mWK2Πːz:28{F+~۫xC[?f~-b8qvdv )!?g?O_B.mxS6{ayNC#2:U@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@W5;mM&yG1,xUIMX_;K >Ү?e:_ښy75i|U"YA)++c?&_ZnfA6!Fm_5?*XeO~~aPuFi$bM6q+?_Ec A5Ω }Ecepݹt%ʆ@s.LK  xw/_~%ys]c@9ȒH<ϲ~_`ً? |jc(,2h8=!{oo da=6Ojg6HUm=A#U):Us_)%}xfs -[qgY>o2@ B ն˂w9ao KuK?Ƙ_-58 Us;u; W_H.n]gnd־]"YތT'8W@~-4olj$Vo Aj 8n,,fR"<݈S9_WP;ؙgq-BJlcO[kKwdpu*\2,?kj?e ׈nE{(eEI+?@\ਗ?co%:5r}N1rp Vef DO<`!0AW +@#ۏ4~]x #xcY"iޅI?vu}aEPEPEP_+P?? Sjӝ[TՊm'Ñ,\| {?|At=!|ZdD}!V8Ue`Tpo~?ĚOizqO33G9s$6FvW89X~( xfķYZBk"bm 4BlqFebq~( -^eWZ~եݭqe29u6P :B6Aso7^ ~RmZ-򦘈r!#zY|2񆏭h捯h se{m#G."E0?8dE~d?_ w&>8f~ԜGy%̰ m@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@W?U*__5׎|Z:֠g [ri!Gt8i% R,Ȭh^ J~jiBO/6ֽp3㔶 _gi`|e}]k4MMwz.v(6F$j!PlO~+F&wkHpcWko$Ekʼn,^K@}6!~_J4ltluOe\o9񮇡^׮-TlkXQ7`eCp 1?b A?b|)3&nu|^WaPE} 8?o lV{ k2YYnC$|@U?J /  h2_x^ġ vy#ʵAPGb/Scx c}o-|=x6~̛̣~}; sEcC[ƚeEA@[.=&@ѕY#D3g$|j~u+ T5 yq%`d*NKn0տ߰>Q5LENIܧQpIIoT<L4O*[B7x0D<'6P/bҬIiy#bP$*KjA6; ePc=kwAٳZEbOmmpp DE `ھxU?O&IYS^xRE 꺜hNBƀ{WtUFWSʋ đ))}.՘x3_Ej_\=m|?mڍFe?ⶀ54:w[;5MJGU%4HF(;C?hb_ ] LuЈ5̘|~ZJ_~UҴ~?jmr  ,f_yLKe?l{"*. ׎8y.~G׃~|PpK;BIoXPATbpAM -~ $b- X+ K9nusp89R??-mNǟME$XH;Dr?xsWh!.xo{{%]4n 0$k~?-,,,˦\we(t=riZ֕2;=VVipOA1Q?`OxkNhݚ*URavQDVo?c(R|'/ $Բ[O屓1` y+\QEQEQEQEQEQEQEQEQEQEQEQEQEQESe`vTD(I4+2|=f?זYtBÕEϚÔcYIiB#Ti~^յ woʝǗVg`ʬd;EQ_m2OۏƺǏ<|!ҾL/.%rr۾ ݞ%uUdlo|CuY}_&9bn36nIFOQ Z‘ƋqTEU@;RPEPQeo$I0¥݂($w+'9/<5>5I7m ,<4Տ~: ,3@?+ԣܒi;W >:6ʊ%\7PEPE~~mAov>cYTcrڕk<1clW~|$z,+'/3 ΟkEfԀ98UO3G,& Đ4+t"({vM25NxOPҮ&WW%/#*X`(_hբh?&MrOV*E&Fw2wT,c+?FҖ7C75Iu:y\ -ct|0}oQ3x⿉Q$FM>8z~ `rV8c1bh 3Lkkƫq2Amm&Ff$$$0I$]o" y!k}-[C}⫝ӕ;awpҗ?uc <#nF(hAsHJ#N͒M =sTP_/U,dڞ$g6y]HT2JA 32tQ(&Gժ|Hu#E 6NlAׯ % {K3Y>~:ω7u_Bm,mnČKIv%,Āď(|F\k7Sc\X-E $f,ٯ OO}|[.ՀZ~i+r Xh'W?iB?2&=Ӧdwg7 Xv]Ү(D3%/?$|meS$3_CH/~ N)%׋5㣮%Ky/0i&*D,6e\}Oח7xG/|lW8#Lƣn61x:(/?~&xIޚVðVXDfNp kk 4?Jլ 3l5GIK%xea,M?7iMn ֮[TRI`Y7`D`>dOqg Ǎck$5vDa-T1֪` iIb[ <φ.t;|E}NH2*9$nq@ܗ?>-hoŚZK}l?s?$Q"4 k,~3񞨶wWWRK׶@]J#@3=J5}'vS_ S@˿h/->Eu4:FAu)2FH-sF?^)ƟE\sDHq %9ϙڟLl+|?-UPE~bM@Xv;Ub˸ ~џ\^M:dF2L3BFE;WE>?izvQ./3$WSA ׫~b_zO >/dYRpŭ y $Kse\BT/4ck-K_Տ:I#v<ԙc#2ٱ8M 3{iGgJ+'NL[xY區4LRhG >KĿ CGRBVl󵳲h~v_§}axEs\h&eܲ&>7@FkFX|d_,%4I5ƍrW9&9 *fǚ.!ƆT"k3q8\0YxXikZ՜?<3\Yj6r.,-٣6#8dYp1$n&ͷcDGkO 1ίm1 }{k!$o&?$e߱=^xc:Ifcb 4dnFR  j๟๿Kω_~$ä|>xn["Z̋AgryrI41"F DUᢀ (`$ǟ)_.m.e]el B2>Ta܎v@ 4_Qi:oYtqƐ?B. [w{Ⱥ^o ğ5IU uwL[t xp(Sd7?-|BĴ-Zk'&Rն-ܒs?ۣ r?c[KsEm~-xWOb{ d*Ϟ+"Hͺ+CSEuo\O HH!G9W؟F?)|;He~^,84p *m;恃k+MĦI%nF~8;IP\(+SjߴWZm4 +U^nAx1(?j05ֿi?kው>:Ff`ϩ۠4bdFpWǽd|b'./>.[s1y /|m09U2)f@E~:e}Rn ;Q.nCsdd2AAu^TΓ3|` cTo_n$n4d=!gc̄d PEPEPEPEPEPEPEPEPEPEPEPEPEPEPU?Gj2}R> BOwe9j.>"x~%k*VKڔK٥g rŘp>P//~ῃvwƇ1Ϭ y7)ɷhTc; TW{6^(|Q!JОa.Di7ђ9'fCCm1] yӒǺFr;WᎋSᇇ|8WL4X ookh1¨W/V]߳߁_2,:\Xb$An_{ON|7,{Qܞ7c򺓍@\@? + ! xͼIg-RsH“є: ҿh.&ˢF/8n!xԀq_ %:^.}GQ\I$N\?ޅ"t_?g,GI~06q.[<W4_ٗ+MbK31+s¿?׏7K&[[y$fl*kWZnvF51@ҟHa4xOh~RHU]\*4rJy? x_eУi>,kx|M6|]FE(G@~xgoڥi~0a'>`D֬1ݏq_oW>AicwShŸ\z'o'3jբmLGd `iprq0rQT v:Gy0%մ:GЩ}jQEQM_<\uNFڽ-~ܓ(5uQm%=H߂nmcIG}1rg6*ho ^:WO8她b#rHpQ_{_?'>&o/^JծOw3gDa `ڡ@& *pR>*YG֧X?-%̂yU WMDBM7 K;y/u7MlK:;D˓(_#umtGn+o@ڗȹƊX79lm5_u2mۯ|/Vf2U@#%?joZi?3ּ7z5K9R"qPDQQGs&6NqZ^Y\f FvfSZ!_x[㗄]{J *6'1$s 63"5|ُ߇ |?|cᛁsgyl  mte(|Dht1DVVZZ~"BF?u3 G* gJu}n΢#J'ic Yܱ\|ag6^ GO o[s4Wdl _EP5[5[+-,\&"RIX\L*YUcQ|><}r+}C⇈-Ѯ8ss5;@buB|;_RuhmEf%M42:ia02H.x#ou~vߴ!y& Dv^Fyt!_u?6N7 X,Qp+:g>µtp2DBF/_.g]P1`NAJ S_4‘ M=Ijjc,帹qpO_̪)6VK x،d5/q-m#$F9;_m_x{Wd tܘ&@Pڤ=pGg_ۇ}dr9U1΁7ћRr1q D62drK˯6,H#r{_?o %5!tzCöhM˰dx̠zJRUIGV7,H<=$+w2foGgдX\ Mr"o-\d![j~Ob$ XEm?2Nz9TDas_ #)/*۲ HC&!o&g .].~^6_EFIm.t mU1̾D 7d TNMRѭ-N2ܺ`8YW1= |#Y=[vy⻠'qmlr?GP%眊$dP>yWVy'mƣxwnnNI<~-O"{ ,{a3I$HYP4Sx`=A݋4,q' AǙ&|rN *c^>yy?g\ vv=/OV{c.umV J,q:yWr?Gc r]|:>#`y^dAx'oR(5onZk{&ex'J$n03)9@!(~VS╾ՓZc|w *vAUiђ|JvuN0Y n0`:@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@W?X+׊57U X^ ^g 6G[h,m"Ai j#D^U@ g?g fm,lhP:#YYI&Z((+[i>4W&JOOq ER̳[!6y꒿-m![?h@I&|y' e)?to,N>Q;|Os ^+xX7 D$U!c Up\ iy|V|i ?&qoWV4wDVUA F*kyYZW5=6Gūxb3xTO+OP 1H00oا"s;c[z;ss&3$ϴe=j ( ()tK3VKVh.#n :0*GPA/? f&MO/CH<a%;=˧hӝp$EhP?=W>uXlxo@k>5  ,fFv([L?$į*ƄSc$ݮx> M~g O+m]m#CL7>(֞"hEO3qy?Q]c/G5kţxwFNO sN@.n$2Le4?_ ΃DJ$[T$^s# IXc gbX/E|WY|UxN_ԓş~*u71p+k9,qq@w+>cFX mӫ}f!TkB?mB?k|Vr^DYph- f| 9L;y߉z2[ŽtfM?P#Ɇ-30̑f8HUE +VQ#,fy 4nb6c g#-eP!?n_,5nxOEĩ#A/.kncjğگůk*/R۶U{#9',ʼnl>Pخ^(;jZ^euZ@43;UTrX;97 ςo[cBԧU#A o"&?o#lmgR|EcþYM 9'31+O@<S`} WxN-amנ̛HAkk/F5Z|H/ MoVN@{gтrXn9*%*sEڬ>k\۠ P"򜐱9 Q@v:_-KE*X!K ŏ?> t{>7|r~_0Z_Kl QE^խ/lK/2񌁴^s8 w_'㷃~&xMWux_$:Ƞx׌g-_ { 6XWq d@+V&9èC*߰7 ¿ckCDi5[mMC0ҤW:+r)|?/ũ[&[-OE>r8ea|Ot[?\xoPV' 0%IY 5_FOHwzzFBU{-h%;2Lm̅0_m_M;>j c/uK嫄i-g@At`[c$?{a?;^sA'IqK9Q"k<]kcqqw/ZĒcċnak[QnpCJ|8~ϖ5=vku{4nߌRU]y!x?8U_ -A%gN >_*@ȕx ֏ud[F\a,9 6h?Q'uy3:YxWg F@6BOGR]*]>wkkKp@ *Tr@D_D?県>I8\?eχ?gO q!eC)hC<]g~dž|D$Acau AY H]~\T]CmBo'VMVS? ߰Ot_c4wV~2eIu rATb#3@Q@Q@^CYMms wb)T2J`=kt=s7:KISW`]FQ˹vw,MǔHVğ/k>Ncxs6rXjZuB[{$R'?E~~zִk}KV5e榉rH}yO 2Κ+zft߀5'ŏ tMROvQ1w^B"|ܒĭw?xoVѼM]G}j6a&$GqyzWA,ƍa]bm;MhN[WP8"RyPEPEPEPEPEPEPEPEPEPEPEPEP\_H~'C/O91[%$&Jii>#{-Cw,<43^O|;B]|xxukWֺf)%wQqQ@_f5+{{l}y#ڋ<nB/2F`sMU\?  i?i%2¼vHt{ ؊+4ge,4摮;h|V;p\6F~˯ se|_gwh#0u8]]0>̞qS__kOo4m`մdM6nƃ89'몿ِ \EǕ"Z m9ʿw|[R">1hsxwK*X|f":/ sGA;ja|F;Mj\у ~cJS#>8G'~>|1b7@\p8L6p`EPSގL=l? xFȍn*3c$4#hʿ/kzc>xᯋ-SW>,@gF{2)@ fP \~GR$C xBJ৖ߵ/ryWt>٢^/\(z]r{uQ@Iy~6Wg/}QCVi;D:mxXukɯMb]CQM#L B濦<uxWՌ]LB50C%/TWKZZ4 g#e9DFA8 c i/h+l)|ck?JM ? [d+g| |det[e,s+dH$nZ+>?5 WbfԾtňbF~00?[0 xV8>=L>viFwKr@}hao5 5ۘxm+)"=1$ß| ¿>,<3_h&V$/9%XaK6p"M4QjH{yef+ NptR[FL++5C Q%}'uHu׼;>VY0l2 `'Ey=lx 8hbAĐHT]i 6;%C*e'(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((kK1 dx3e-'ׄ-{^Ԭt}GeR#UA$~Cxg2jZo_\l95ہ:cp,Ȣ lY2fq_Cο^VM~ះMYMJǜ,K  -_F_-O?&[¯7v&#i߈ {?|zѬ7"wpipv^w+ESt|=¥վkF9Wgn89anxqy ٦#S{*yLtIJƽڊ(i ]wCPEun?ep/?*a?/ _xG}1Yοsx' yx#P?١{{%:Qo"@ڥHqɊ a_ZFA$Uݟ0Ip|־"|J|-Ǿ{i&sC c-,xT@Xӭ|RUFQ$,oИ9Kp+kok'Pr1_w c oxV4]6V/ƕ@%br̜vnPux ^ +ܮ<-a*! ln؜i>"=`(>ۚƍj@4וq:&FaUH_aOwu |]+a-AvSf NNk(<;~^6ˁo'IS 9AOY%j;-8Mg} O ç\(ơvu8"'ќᆥ⟇<NKr[$V$yTRAcoxA?k144HPN/`Tc/&x6/@ E>Y-7[+B8Pvw^yeqp'#n#/,|? jᵅY$ P r~|^" P[-C@}T`|Hd ;pQ(_?G'CZk=3mmP@f,qwb9A\O,W?[j1M|*<8z0CO0`|p[(cJ{q~оgCNjş p]042L S'g-4iuO~.|3Cè\/ڇX`|_ &fWA׵_%YM޶-&rxDaq)Q]Wg|IFRE__'PVldX$'EP_?Ao!?੟W|?hib8m BhkQMwf!BOP KM4;xn.hgd <ip\[LH䍃$FC8 r*JX_!5>}?W7.FlG 䩓򆿾O??|5]*\k%&GSWn6𯈝}KP&M2+5@:+Ƞ~FVbU'cC89@?xf>ao}ٷƃTۙW¾,Gq[()UUM?d_3xk⯃uц-5;S*G2#;@@ H~C&?<dN(¯S3II ?C?h_ٗcxv떲l:FXc@«xeeVUdHVW]wb@!&gy33:?]^hV<NWd1*vάIf)Q47C\RT*Zߜ2iڗL<)R1>y6vJr*?`-,tF'5M?Yʩ(-Ƞg ?7(O<4vmob@n{ɻF0ܭbxYfUUY#9G+2klؐb+?'^bK{]:/豍 lO ʃFE@x[V^ủ.Pj֎B $r,9WtFt[6=J7VU,C$1!OಿV߀YكBu߄uυKX!h!jQuhFwռW[NMZ'4I=ơm&[;.I!pJmnM;[?ii.44Hqsu፰C FEtQEQEQE#g>C|A_[.m@Z&D:8YA oFVn]x?K{Rl/ q@';H2WA`OIfc &~joP*x܄u, 8_DC<e~A3U[b%`sc}qހ={.m~Z/߾/\yeEĶ zoX_[ !?T$6e`-5I\Lu^C#FV.BR|]y<{ZӠCnB3(?i?9'oxO>Hxe^GCʲ=+((((((((((((=RM3ޯng!gR4ᦂZZ|9"t,ڦI V‚9ƚ(?5SÑCτIvy>9B? W| >R N;;c AMB;tCYrXK [`X@b@_OOۗᇌ] Hm\y~@H'Y/o{UK3qs7.^NpH6֦ΗyfǩFJ9u<Ć9p`1cU5%wV:mshJbƼ(jī6c<3a:C,#Kc!t8$eN רPl~go3[|Kw@2|"7 Uh zn5V?V;X,|,A+% x;᷌g@wUw4XҾ)5ۅ jv[wc5O$#) gi7P7}Iq$e:A ^(?C⶛%M5?mrc9fWTN"ڀ w'^;CDG8ŬcE_>S?b/(G+MGiO&3 ]J' OayB(V?%?hU_]W> +ozi[2cq*̵櫣MZMݧ}ZE$,% dl)8V 5bP)?  5u]._Yʷ-ku$*q`C)e h +5~4o^m7VXQӧVuKdCq+' KGV*O~Sm.ňb_xWTT6 i,%'IQ}~W?F^%MK&{Oq7yKA,ώ5FFޕkae@2 [Z?߉ ിf-Wz,OU[ V# ?i߁78xάt~B#bnr WuE~'NkḳԼ?w-mosd6UW#=W,9(l|hmcOjxUEq .%@̳FsnAJ>d)/#Ke_Ə N_vj-If|e?ؒ?)_aa&u|"5w+̌0s=]LgFJ_7; O%^k K?h)!+,Ko-<ëyg[7h:<Y'K6Gq V"Tow_No+|]| ?8qŻ>r@Q(ʿTQPiYCuiuxFVV SEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_toy~x{RC^'>}hv3n q8' M*g3bK}C']c5?~BW#+Kƺֽq%i'$&Gg' $P(_$My|6^6_ ~U4pe% D$l<+ [cyogoim0",h KB@89?:>Q ,W$.FBRkBFvL}kW~ ǧ?&gg9x^[{pF찷񁜀f|-oɧ7#z ...m+%>g#kML3LpI$*qf-6ߓ$W;IK##滧v&ݘvyqlEr_‡'k=cK;+y&H.Q@$R|{Ϳq-.Z/2GY %A$/>hmbFrMt__fèD|]7Er$[G`Yc 'Ro_ U/kKi1{A:\S RumWpxCTw'˽f*w:2IGuO2^ugmEDz+Au/Y5)YZ@!.ǒ$n,\ 8ˮ~Ϳ4Ox[>oKY^%4{3\~OEt:׵oXkƬP þ_y9nR9(vwn_t[&lȔQ Gp21 #|t5jKG HG!d} َ:EP_OQŚ/+R3[2Ŭ[vʛ3)1Ԃ Iᐊ@\t?$y[X|PdsXx/HBSooYf2  ?~'jyx\}K[nVIn$s$䟘%sCb9z؁f'EčR~4j#Sx-2my>(efN o'OcClo(|ԛz|56.`ʡ?8íí~Kt}'MBkmkQҀ7+gme%o5G__ _'Df"y9\k9 m't }?4FpxY% rU6M~sEl;XUV85Y ~f06 ?ɏk_>0]DîvSj#]\ xbd:M77^҆8I$1 WtWr/~7I&5>Cy/۱cwcpƏ=__ÿFXga .}؃ʂ?(?P?yo౾XeM?ZúЈAds^Wh9TOkn_NbM{i)]| 3П ( ( ( ( ( ( ( ( ( ( ("Mh,TdI=+lຳC~#IឬG—{xhױ1򹳌D_џ^uٟΰZǞ m\T Q L~f Y7~ExSů~u뺵zfZyV00 9b1w|3?hߊ]k.UӴ>Y&CprQCnv "| <1o_So~;$+Yp leU| KOPƖOyZq4>fj:2>QA?QEQEQEQEV)XZ>m%BXnJf;S^0˺D\R_uW ࣷ7$Mo_3xB yhqOP[Η֭u]*KkgK䵗2K&6+@ xHOxx&/)S-n(Oyr?Yv? S4x&-_2A+ͧ!w.kBO))w_HxRGrV[F|ld3 F_w?hO~ʟt|7N/-u:mJC'Y\lq`i< o n-g,O =ՠnU <,;J(ຟ,O+]L$\4?0S@.N|"' CO{QiZnsp[QDI 4s z|ͧg>'@akl_)Skn1~Y'.ԙs_E?5:__VO,G=W|/ 1qqpY\lScyS_6~-wG,Ok3Hq؃ { ? (nZ5PajZlPIڠq^__ro+X,kP${dB-T7̹' 9x|atmC?tQgSxT%~nb s M<[x'P|uhZx~++: /_̃UhA.7Rh~&|ZYg1xI +$99 k|+~^.kӼ3:MBC G+(Σ?(E2Y5]nfm#,6aJ#Mz>߳o.9-YFŅkU-4\y.#l<[lď.o SӮ<ۙB)Fbr1㣌j?Oc¿P#"4nv 6xeŬG" 8a@Q^CYMms wb)T2J`=jZ( +R,~B?;!Ov!!;`6*?<1ާh״+Mksm xk G5ʟR#o*Wmfki2m\I?yq_͗Sio COz-6y$Zբ!Q e:G2_5'~j{ x> 7rHեӼirFǨ@2Ah+_Jּi>]Oø]K$ C41&>c(fo}OL?ĻXb1'99>b.; Þ(qjPDq 0 sӚ_?:n㯇54~q//J4 z$}1e @?:+?hk߲ŝc(e?j¸Rɵ#ee9 > mbU #\K@x$?5]i=|=(u\xPuL4i}=O$Vހ~2eπ M0?A` imnp+(+_-Iǡ٥~1xէ<< ^_Rjtc>>-֘w%ڤ72Jrv(G3.wm\(=\ȒxNw)l8#eՁ>q\ֿno/>#=Nu i>Y|+jW!a{ c \nP+_ =_Jo/VP,Џy`S_L6?+k2LapbXOL]w+("IY x~*F(Mßh~c n; 7OG (0~dI$I&*(((((J_Xf{x;}/ZjIqo<ˍ }$8`X ؛߉>|Hҥ%H9Bۏc'ڿZt/MgCwC%/Ɣ96O}' ~QEb~?F ȭ/|KS&yqz8^#t08'O.;|nKpeqc|m. 4v0O OE# ࿉7/o\GIu ;I%?eW6P14 : d[\o6cq.]'πQhzcռ3\iKK˅=H>?mk׾ΐDo^") WB?)+2>fs$>j27A0ȰF Mԭ>Kh'20ʲGbV,tx<=,wz\*~+6j=j3x&Uү,d[v[kd00HN _o%گ#x'W9p-#I=\(]{OOTui,5IlPuhB?c_7_|+ j+jt+͈"I%H798 *?8D[=ڥ=I k?xsO<'y{lޡ 8+ a(XWEռ3|na%oFN{ ۾.G6&7rP~uʬH;<_ui_?_%uyV&9>Rr |o~.9.< ( mmϝ~;・m/4麌Ɲoyk*Oku r#U 槯տJ>.k/phڌϏ2KL.GbGok9fg8Zݘ$k c|K|VePX-nEۀ\Faп1dĿGI Y"|I'NsG1ƯCCťX,=Ea#47GcKlvr9ahY?ັxv=cg\+|$aI/j3YQRe@2O!@! XK_\Ox|J" q6#ov <|,u8p9`4QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE?R(߲; kiI [{Puc ]y;YDv<-{oZ狼S~ݔ]#~&-VOڲI5$̪֥{$n獿nğ<\j׈*vAawEmg Gcf<+{ƚݎk ڴol@%8`-!Q3X5~~VM{l&4ԕ 8# E=e[؋'g(b?BYyRpSCZX> & 3xoWZل #0HHUW.|i~BKU/ˉ$!9h󂿰6/oi_ٯ9$R3NYk6'u82~\_xm .MbFN M~-PEPEP֕OmIt滑WɋjX_RYxsV9e0BРP"zw&~ĒrI'T?il+]&+º%zK{7(2 pL'g_|ω4YXn1Z[+W#bIPNx⯋O$ԵUIm#\̣LVV x ti^ $.$۹ےS Ci'o:/5iz\r,ip.Nqi$6E~B[(ě)ŴXjd2wC`ithX⥚C(3i me{ # ˎ喿ak+Ğ&~FT5 /qwyv 7KF7d62p0o9[bӿ?MLKj6Ʒ;rQ/ "B ;ा .59!/.S)s&Ȯ -mA ((>5$ޥ娖܌FKbwqx@ _폇=w\i,ۚ?6Y6wuw)a-?MVU{ W_{k\$ x'8EnqO?c|Ps-?6@]d-@͟%xf֡q0Ѯ.neA;a__O5k ][^'je$91߰oثF¿:2Ӵ[ˑۆ['35~ i_hs|X,,;{iU[ED`$J?J %5DUD@UFN ( (??Pm/ xu۾ ?ٞg GVD!p9|s_?|Tc3WRt/M٭1jM1Z886 ʤ0_UAޡ#źƻ 5k_7...!A,n$9ے(5 Wwŗßwh{2Zv_@7 nZf4E[}Vd mlI xA(R/Ix{Р(߳o V//_ hf',AgO0@p hIhُ헟>6xQXȲʶzݲ^C ,-W_|8x7_߈JRXnmWºI +ѯ9?dOߵ&?aY"x91 O(Aɠ&k3}-4G]+ll!l N~#O$?_ .qR7ZGٗ7dda~F?+N~yi}h1֟1H.KA㧄8>7|Y`w(/7$Â@;om|w|F?#¶ \jZ%i nQ~W$HvF>oFK|G=[7@Դu~W2eF*Y8;y2><mς F'\BfQ7QF㝵5OG–/~\M2*1, q=pZ%OPEPEPW)W#W[[vOxgG]jR+-i$##w#?CxǯD7Q{\H9,FDqUUTF>gD5_iWo XD<7@2+orM~cZv;-&#Y$#rCX`Ŋu%t77w/M- =2D%;LRF6BҾ)~zjEu>%l#oդ۴}61LJ=KD4=3Maa5""t*QEQEQEQEQEQEQEhUυM>8xVٗH$QZ-vIɎC1a_k&xDSӮPqa,Lwzi'ws hROM#ޗat/ Y3S#29A@g^04]kGѵlchV$RF܆*9x  ÿ/Yʖ~%䥌=.;N0 v#gֿ3S?ĻX8(Hbs9898"/z?O1|RԼ5#ɕTN 7r~QEQEQEQEQEQEQEQEQEQEWo&o|ymoxL|Z[1#ԯ~WWUm?&v0%Zdr5 }h(/7ه |1-Q<צ-A)cauS_O(N%1{` ITF('n7׶>Hws_R+-yᇭa'` V sK']zG,|3vŋ*)Vl D* ( 0i>|-|Gt ݹh_Y@u!})_ėW U&7ǻncմtz6^tr2ѱܻB''_|:oZMG.ộzVX &e@Q@7vLÿEh7.KDwE˻  AW'Ox7i{QXD́d8AmXr?WOkZmCTl_!_)[(?L3_#4EPEP_է-NoSA2c}W!IsY8䐙5d )uݖ/xX"SEiGodşqofIB@Q_O/۫៏mU?x*M>ine%5g ҵ~' ad6de4@ʥ2v8c}Pi_ڧ_? dvw(řR@*` wq|KNϟ?ZAfG -^Q|P_^Ho^K5 o MC/`&G-.G-|aGI̱-O"akJ^|I%ƣvAi!U;$,FsP0s A_eM 7Oɒ#T0xŭ~Lѡ?$nr m/퀟3j71Q4hzf#H[S1(/-<7 ]MhXg͞?FHoX₿xn~{UmvH5O࿈>"u%-[.!"pʱ2@!~<+OY.w[IKkmúx$JO ?~#мo}H ]A o;?XπfăC]AX^x39쮀? 5??B|E WY[sR6ԩS,j_>jz&rK$䓟Qis,>b܀#'@A6?`_Kj-o:jڄ,M.d<`mgrX} .&k}ޅYL^}B]6[|yPT s?MOئSŏELpll̮.wX.]hm^o6?\iJ@-ap r?юC|_#CIԭmf=#MFNU< q;NeRbc ,9!,0PÏ * ~C1x?ö(k-5GM2LIrI{tʈ3&㤟c7q<]ju$NEO,(`r Yid&Ư56wZ?o!啰>j:M-NkG>ZlYvD"XuG@`rNನ-vh5 (Q '?/tVp&H^Gq"aznHFO$/@u\~/1x⇈J| \FBcڒM'G,P'I<Zu{_RaW\vVS @| ϲ_Uo>?kmbV!mJDѫ0g|k}|@ X ]j*#&߼ |j's J+~ĥc@$P_S&=W{[ LnG)oAmo|\ݼQ:;ī ;Lp (5/^ F'|wu +I܀=3~X-Iw5C569mB'mwbF~T\??_&?k T7k%.o5'[ojRBrg)a3i^|B>=k%x:ޤ؎I,6 `XR h=Y,@8_;U-ZU6>_\ϨM++[;T <PEPEPosN_[IѴ 6~U FgTP aI?+/gQOkc_ǘg mųX"4][?j:Ǘi{x2G mݒ{76xjCGKP/=6%ƫ;$i(8XV~*?o;Ŀ \־,Kľ=^ iMW[^H l0ߧ?񟊚7,/g߅z& [X.v0٢]/&9Uƺ(/' U~+M7 >[s1hUd;Cݿ>EQ_kōB?|?񎵤eluKkP&!\ e(ҿlO~ [C>+xu74F FI w2u1E6YVGeD@Yԓ@3+׼}z~ݱl*(** WP/8gei7|yKP<)9xWe17-nyjypI}MEQ(TU:TQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@~x{>R| ̺fģId,lyʵmrLK?|b5; -ʋ0#gjee8|]kڗ7uw2 ++ߏ?p{=j<7jFYi&غS%=1o~ߵmwr,Qi$Mi#*#j;@hQQ\{o̡у+w(((({G~ x~!Cu_F43ѱdz <| o k\:LJ&;mZE/8WQ;[zPf<c E1}]Ɗ|=\m (M?)ˋ5-KPYjR~{Mw$&h>+ ;JhMIj:R&# K uUtF~PEPc~ϟs/~>׾']k4L--t|Xg+O $ >L&O/%_uj10sbl܇Sf<_ 3÷`n<9hmH 庱=IfDUBS((((: iqCz]༓i$g S O[A5|)f]RDr dBk1WR\j<73dkb $IbI$'$}Q@Q@mW kP#+8'SF4?=uQ77sjR_xO s4ăȺn|vd }EPEPEPEP^GEǏ|!k36Kh1$75kJv uu,1g.XYXᔐEW5co؋o|-,~@[e ti.W>k#k_xMY/]r EuTQEQEQEQE5F 2I<@A_i~2kɥhQ˭]\[+D`H˃\ ƿyǠyz?0+Li8y~g'?)@RqhڊG/x36%vh}&.A.~PN#鏁rg_O t>}, 2>䢳|#=mVu&]%ͼ{J((|4(υo~)|-9h͋jop nUF"G8.>,Ƌh6\=m|dHې_ O~Wo/V?-mXc.ʨSZ0RzZ^]iƟ4WVv ŔX@(U`ݷ  ah֏yk5^\˧ȭH Ur$@߅?u;_ZHn+ ~31:5 LyiܱWO |oڍց7zVewYY*6k)׀|?Cn\CoPa%nܿ.B~QEQEQEQEQEQEQEQEQEQEv߰ǚ=E_N0ݤI\@UG_?M9?m!y/CV[$ڎ}cbu02/_  [%kH^^Yn# }vG,6vU17Ev_/k_ۇĿ:߆|E7R֒__/ K U)|E\k Aɥk*aYFrAF?rGwvGǓ]S2x+mxbnʀ\U%~^C&) ƟnfRS4;ۧs[ġ 8du&.W`aȓ͠M>2~Ě_&=Ԅ<:}5[0h%\D8W@_Ə[߉mMl&wyVIV}H[!m~G/g_%:o˪xJV]OOfVRRʎO q' 4P]o/& IGuG$.< cOۧ<#;<%}nJEn]IǺ]Ĕu H2[6Fڣ}V9I9,KcΏuh2'a\(R'tdܥ]J _ׯtm&G<yB'XvͣWkX"[r *j~_[.|uRh~)hiK0XQ̎c Yܕ"d ٣ֿdo'k ԭuKQ$Ix ҿ9z$NㄴMFD$ٻgi7N)<_?kYxK#O7.KO1^[zMk.H7~ ս> |Wt/.P L88G@:V?/H{;%dEeo:-`TaSew Sh@ ~*C,-kBC@ɂ0@ y\VR2'2_ |@_GF|],N۸%xBǑ.NN;_Ŀ _77ٖ_k2[;BMy% +ynnfmwʚ 㽘4is;L8܁@ʀO?G*wI}bW,v|L(8dS㞹x}'kP`k ;|Id|+x$}H։1G_ww ZV9ìH3\b: bqI|iؖmv;^"+  A;fk|M׼3ˤ]P G&W2A=1@+w ]:𧌵YiicFV_"VD' 0 q%?g}R;cf Ǭi)83@VÉ><7۟ொ{Uмs.b2naHV/ {ඏǚIx6B#>q > qn(ů6o ^/C-"8ͿuW\ 2EvHNcc' źi3[jZ}Y:&Ai gb6򦿃?o,I'5"5[^Piy[Fvֿ8r8|jlNEmFd[YF}Lw Gz87C|#. k÷b6o݋{ǸpH{&=t5M!xL~ .^ܡEcY;sPw_R (OQ}6ڭh74Zzm#s=A>Kc2!5~+aW-u$rY`}}{kYb#`S{yp{8`%7^kλjV?|5a6_\HmB;*_şg+/*o_ȶQgE[*C%PLTm1RI)b@bg*}~C/x7XuzIj٫+X;tfW\8"mO Qj?P'Yo^i{ćMbo&܀l+fRBPWW>/>?^69BtۋBKkHZ^y`!  x p u?z]\q+6\r޴l`'T*\q_J((_o?}( }hiuivFđ> g}9n.ῇLX#cqfӢr>-9O8xAbx}&T! #Jűxk<EM{NjBt )Uk\.q@]7Z٭~XуLaN[6uo2e8ff$$x T$8hw 'u*ɧ|^fʌgd9HœT$@MqMq_"۲ M_4Cn9+̶8 >lr_S2M|1b.,eb3"%9dm4.?5? j4/T%ŵҽ Ih IOLqrMcEPEP[:&s׋T'om2=)- V6 cQ@)% ?٦[$Ʃq[ˁe3cEk|`[A9(a, `IOEQEQ^~6h Ꮐyxo}:Hn&pƬXNͱ!7 ciMݔ |j0q6\dU(7_cM Km-46q[Ċ#E*L'7߲B޻an5AD2z!Qy'Z(((((((((+_._IiY>hϠw,٩E_pS!# u^[x&o>}_qc&_#.Virʙ **~2xxOx BĒ]JyED@R7.>-^x>&77,`0E\"F ]wƿ/W^(ȱ4=|]U6,0źY]jơ4V֖5(I.YP'/72|ll5?w1 }!4 GQUpH.XB?=wA7MX|B7^[c$ JAʘRO((+'9~KPEi7[ZF^IU׊E m#V#SקQ*2Fqi#+U-*ggN)XZYlqrߘۖر(o {[٧Ah$ǤBmm\c2E9?SGϬXM#y6yunA%Hu-Aߴg+φ? u[DuƛT7C3,E6r|E~|-*>=xn<];_^D[JH\|'$Ϗ>Up|2~_LC0>$+WG9t˟_ 5[WO-SH+OA)BV>Rx~71 k=zǟ 75 G\YfKY&w9~߳+ឪ=.gO*ILy ʲe,  CR^~Z^jSG;Oﭜ ƲO Rh-K0dd2AjZ((+x?_T'RHu*kEܑ$6B8j m1jWly.rxHK15N>*x7 NJ5J[v>qLIۜo 9$`9:(?/2kQSm٪4<'!%8& <1ZYAd͎h' @Q@Q@Q@Q@Q@Q@WMmM? |F}u-mQZC:n8PPo~:?%b#$NsV8dZ񶷩|A񆥭jwח%rח7#3#IbpXQEQEW z.u_^SW,bͅq2x 9Z᫚fvpPŁ + rpr Q_#o?Mx* F-QV`eCzN;W4QEQEQEQEQEQEWsyU[VuoIrWfS{G w@?:skDPnגn6F902sP?EP~^%D|<ֵ RL6Jq媬WQ;bpKKW6h:jj䵽&UBrFA+^=־xIWumKA״ĺu+IZym$ltˑ׸5dϊ:֟wČWՋ,0F06X@/:<u4;MmS 5ղ ¿w;Oj -Ga[^[?Px`#^FK0H  O_($-m/EApF|2H?W(((((((((l,:2J?$$Lęg<ãݶZm4=A 2ѳW^Gr~~$[w΀}L\no6nSf_;|yu_-m> !e'w- R@A+|$o~V =/$Fd]09(Axs -eK+0g,NG'ˌu涊2g9Nm6O=@.?on?įՙJGqu:8̝ ks4:/Oɇ(u 4r0pnW|A#>"X4~`ČjrNaIn se9;? hoi5Y?XFP:8n7Ǐ&ǏfP߉eԯ4Yj*<\${X/\kyVaa+`dae+P.-#xS\u+ÚƗscyTWH3`?\ &Ha}Hd 1qC 2 bQ@Js|CSl eˏB)ó# QN??Wۿh'^5Uy$:W&Ulo}uŞsʋ0#|_~/ǟZ-cnڮ]6ܮܐNccI:?ɯ-C_> G[|iғ, K[gGY9[k 4g=JoƁm{v-6h09>PeX~M3X< 7xך fl! h2H4t5!j^"XUkƅ]&` mmW/F 7x /,ΥdbOYǔz-Q|']iZEue6e|me >(xqx_TG6w^M-fp}TegSWCx{ >MM];Z0ntA(2I\#c$+ko"+JOJ-%u )Ƚw̋ddtfV'Ï//ZZIA{o*Dnᔃ[tQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW~oUA[c8pqRr!( #1Ľc׺?3I&u91zkB9?G"O0v&jz1-ĬYA#h$*򪢅 2((7_ۻ {_]-#xf@^86Pg ǿ3&/ uk?'\4up<ǀ̸k@ '6?{.fl%HYL|7w}}~KkV>,xn4?  |f͹#$Lp8 ~?n*gŸ Y.x\I62e`<VID#nT:5>[}rDQw1Ԯst - 산඿P_&ƞA,` K[>/xoxR׼U SQI4啉ڡx@ʪ1eQ]W?~"? ?E|K-RCkmi6{ytFV8 OL<,|t4_㦱gC/涗g"B}!H%l4`Ab?c7  o<# k>h16LN^8r f'ixǭRوU,1B.D 3OՔ{$~V>(k.FYGKCܭ3:i.KsvdrIX }=EG)k G,qơQmUIEQEQEQEQEd6wď~ šx/2:gRG8*AOگ 5߇0=L$غmj`gZL@XE1v@O~_սt7b,q+*l3l+@O k_ @8W2  tW_ <cxk7%q$>$xs6{ߒ)|UE)˹c_a2xP|%xCnYk[$ި牰d\aY[EQEQE}cl_ ,> x{|`,V-ϣ7OOΗ/P_i;[CU*ʿwogfᧇnMmaS7.yHbUi.I]է] 9J_f ּU,#R֖[h(m{c u kJ?|8.7WM  m OєQEQEWǟXo,$_5/^>ףuυ!Gq8+`mtC7IWo%gi|A}\渏|1rs)ke2Hp9T{Cut|t־"F.5kRi  @DU\'4 A~9_%z׈)Xg[nbq&x,Ie+a}`|l:CV7L<9%V'pza?^kiY[ggj0A8QFQ@Q@]&^.,m,hgxđL0rH@*~WA-^/t~Ϥ60iQe1qkPEPEPEPEPEPEP__wx+]8OL$)!e xƚok"֮ci$r}Tnō^okj+جc*0H bQEWeaT/xI<3kV:%l]7W"$: kW ?R٭|c㯉"xѵgݲ~_*DrxX((3O_N?VƟ yze=[9R?g>>̂x+Wdfh&YSq0n$tOڏ}_o h~8ѭu<xM;#;z( ( ( ( ( ( Vg|rͩj 6Yna Y"A*9K^9dE*r<Gph7ow^2U:\g*s,JHW5y~Govù.|#|pш̶I$MmB2lu~~4]kc3LMgBU[RV2"~ql㜐*((B~7_׍4-|Au E=d7-UbY^AU׵N~xR+ϲ5}BKYe @7;F!h( J>"j>,iO{-; o 6[\2D4%Pc/'^xKN<=iVomi*G %Gc;9Eڛ»VPr!   (,K$Լ3O hgnAhİ9nXpXB? _?,3i-;qAG+)%T%wo%s[xحhp M ,--?^-O:o0f[>FμYS*]>?cAyf\[0BA#]r168xK eÿ/lMX\mykwb\+dwŠ((ୟGoV?(ƚLmLbUR =sRz|Ir|}/M/QM?U7]!\[HoPB:"B?j۟cu/Yc=Ҫs3XIiK Vu%rZytutk ՓpW?!$o9-wRFF>\s kM\r .|5@//|o9>~p~տe QD&-?Zu=[ 6f9NG,ҐW"i/nj\_\;#UOl峚5 TF[dJ x+_R]/Zn#C50xH`K>*Qվ6|E.oƞ, =GL-[tWPȠ*@*A~|/Z>kuo[N71p O9_e?^~*|.'el.Uvwȷ|:mU|mi֫mߋ (hcy6`vQ<;HG}??g4/E핰i8!eEm?~S=sĚNm|)1^vja@!nU'%w 2AGzbUz4?x$~Xo8Չr29^EaWÚREg6V@H9$\25Ѕ:u/Zv6w\זxdGUp# XgS4*OcV # +c~Ӵ컍8+«0ºʜy hQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEToiZO<8QFY@xTm[[j }P㏉w-fTH9I.e ~N~?ןTz+Y|'l( NF뒣lIeRkψ_ʿ%ku7WaҖ.'%B6(S2xƚF`;Lŝw&@r8xeDdXh_)g'QˣWmF="罸n 9g// ;'E,-Kv$mI$ĒIx7O KD3c6ߩol@Idl{Wӕz߁gP_BF7aGlfrAz1r\9$-,Fr00U~x'7<=[̗֝n,k3mXt)jI?Nൿq׍^x0j_~ i܅ԼE$1_-HȷAhEQE}{8l|DrXx6DU3OS"f&=͖U5]+J8b"⊩g* mRlt|z7P룔Y#en|_[ݡ$Gd*ix_C/*_ w̌%cMOl'<'hq^EQEQEQEQEQEQEQEQEQEW('I<+g:OvȞU$LI ``}_iouo|9.'hL!Q-` .2L|nOL?ĻXb1'99+G |.Zj^2D:__R~8mx KPErAcEz}|G5%xoR߈;|P/4L7>fSVfvpPŁ + rpr N8CsL?g*M5İF ڨmyW2~W3~ լM.Jִx'Gʲ0;H 637C _k@?<l`QsTB(QEQEQEQEQEQEQEQ_W/8 .ˏz}t=ϖ (;?gu#7t xkKBZk""yn Ld~#KoEԾo[羑 SȻX9& wŏɪ\ک6zl,v +K~V0U݆wQ]#~&/uox^vڴ䀬rYP_c N>3K va"}D8›Go|+]! cwf?yݺ,ǒI(UUU @: ( ( 8i׌.a/qψ/bC*d*@oMٛ\4YX[kj cP* G*'B4)aMے $GH*O|uu%vO.;@-tU+wb;Gh_ 5|Is堌iF3%vr\YV+J$H3w#2$,01ˎW,߲zlj/ XzdL?2wHw+a@>^3tx2n5 w^!$-ν|+L9 Ջ3}EQEQEQE@O/ Mhk XZKm;_mQ_2p#F3'*OŐxϭGq뺏br9 _.j*9cs螿 ȏ_/>\f6)႞#Qw8SUQEߴ_?d*I4 ?OQT|i(MvZkwW6v6Q4#gvbI5]?^;?RxNqyG. k8$obd?ۣ?nڿy!]M6;Hݏdޟ'xG\56qȃMw((̮ĒH( _'E xS |<`htTQK6iYlp `(ը((((((l?ڧ>2_/a2X_>S,'9ZO+G~ kc TjW(wO g (G;]0xfxı2#uI%Hr5qo+)bmAAӑ}0a~~8YԾ#^`9 ɦ1-aimo=Qmv(O$I~6j.|]g(Y/:uv$c`@ݟ4v̭ «G$rF"9]X7̻[~FC_; CjRFG-J9% ;[P,AwXף]"+w?vD'`U>EQ'ߴ\?M=~̳m`e*s1t`ys柳أ㗇 |?LJ_Vã#"HIWSk%=c/:|Eɨx;Y{yB(< x^c]k>"/t-{7~J6m<-H3 9< P3ux/ :C -m?hE<4 $|^Rdl2؏G-E,5 µ|:Ż[O9h낈-?FEkۤv$\N8-!r3UR((  <;:|]~$޹nۭ֚ŵL0Uс.p_k7?f 5_ޟǹچ<07-ܵժrHyTfElouOIqnO2E(2{ K,\5ߴ_<m-?{eF $eI&b'k0$ 6᫙e9-qd") Fqu?a_Wŷ^w AV2O^~?`?>A-L#}BQ3IVV 9@xB+_[t٣Rp rA)ݜipH<((((((('o8?G^hZvdU37r+7 1# k'П\+ƏMtw"ʩِr`r?#q# [=k&|Avڮwp&2H#&6 @0zź]jơ4WwwW5Y.Yb'͢(jW?LW j.Vش,"&W@F  ȃs9PQ?lM?^=»^6.dpb`w eڄl* o^>#{.1y'ee̱\H )_1Y mG U.J%]Quj= d#]'j.kJ((((((((((~ޟ_| O kv^i anO(5PoGA|yq/"%n% Zf";8_n#؎S LE~߶?zx_wV&F.{ż4)y$!I(W S=/n|n|}#Z[V}dM}oi|YG׬ӯ]qᕈ#?~ޟ?FW\ÿm<9K7lXUIKs:ga˟Ҁ?_۟gcOڷ7e'O5&i´,ڼk0^>ѧټv?Fu;4Iagxrv=S6 2տY<4z_4?1Gp%5d}gߊ>6Piz<2\4܏hYr 峓-tx?i$mhzZ{nۢT}H#Z-\Lj4ejJ|r^%֚,{'3WMQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEyG_W icS|!Ё]VmBZŸdVH'lH*?k{6^RBmlQ@誄yFJѐ|$Qpϯ<2mTT2ڡ kF?`O_gs_{_³ݨںm -\dP@?6|+~xGCk;|7} \ҡ ;_zf#,O\t8爿i*6F<'C 7w J|u gF>Z`+yG<c3xCΏhk(ԭ9I)Q.,mO0Xs]/o࿇"l|Zhbo fm$I$I?iÿw^,/|Oްα"4j(΢ڳk'|Q+k3m%T6D#@|o?*%']Bu +e`Pr˃sOQEiӽ٬jR:Q,aB0G$0%X q| YMQA.ū}?W9i~+wcvéji+_H<ϔH1_oÏ=m/4xwE[[ 7NKk[8`"F*+r((((((_4x[Rk촽[ˇą2p j=ki~Z >b[k^-ItF5|8oT |kGGmckY,-KdRH?ZY?lO?[ּ_Je$k61=Ƶ&BicAeBnfXI5oڛz,jH^ ~_زlu;w' !W@=7?O ^2_RW~iPN nc|nT%I@Ȉ22GEh_G puv\z~+wM'/-鰰=R[ỲDMHSЫ׸~߷?3hm,5Vi-R :0-`Q__Pr:Ox6pa} w6߲߰GqÿqxUg[_f3X\loPZs@WQEQEP&¿)NU]b,zp{iH;Or0(@u`(U$į$6ac&Fþ+UPCmul7 W9 7J{_/K\y~$ hnmhX|JȄ2?:+-w?IF\x_%so10Ub-.cE.r_k/_kX0jQ%#Y pPE ?eXT/,GVMS{Y$@qۑA>_?GEoًW?rI3KBb ?.UL'kx((((+i߲wˏ|J^U[tv#"cwU?]7>,xG~juΡ RU @'dj )g9g ]RV/ڲm%,r$l=ϖ#b i/ڃi&axW2J.#(U?t?V;?Qix',:,ַĚd`t%l4:WFyxɩHIv<9#qba]zA&/_uk9fbR2  2Ipȫo%3OTm&_;˺nlIK8r@~onpWihQ~mMȇ n^H8qcqҴ]La# (ªUPͿM_$%~nymD,ڶ&F\?MQEQEQEo_ou >]yI*rHPHwb e|3F ]7@^i^I!A# ] ZhZ~YF_"JbJ&f,0z0G((+?lώV77̍~ 𾣬>x-̪uyq~m.&VZxz?%}m&_<Ez'=s?~ZcR4i!*፛lۍ0vS?c؃ QZRzln7#טص m^4IORIϻ _=Qmv(C l ?;[^rm3q?q o!N ]<}].b,#:__O?b> O ;Jfnel``ltS[ĞVB,{=s܌f?*5 xGִˋ}GEeʩ‘XtP]і?v-s=`XUH oCFTzu~M_'.?&ޱ /!8n#'o1`@d((((((5!|+jdEԖž x6C5SrS(=߳ſ|? 7B*9ˇI8Z˿ిEOWZX3Dþ,4lyn#϶b9BA\I9Uo&?&[SiRϦk6ٓN֠0]YepXddgkc-j=ɩ|6Ԭ ~0] OQEQEQEJ4ړZ<~]= !_.Rb9BEA~H _ĝYk$Ե됹Ax1r@?3 #u)|'w-t̚r7%䐭s([dj7fqE>".h{nYXkv[s0V?:9B'(|oH>Og?C tk_~nZud\0I5?ߴ^wܴa`tC!KX 30qPpXkzBLg3G}OWRg*P^;]sFUԫ)*At((_ _ [jv 4Y>e S|aPMip-1nuO薗ۻNnl![`pfϖ7+HR7+w&jg8~25&=ӽŤv5NI"^m\~xӒZ&'pZ{ =L|\,t |VK U8ڮ qo;L!?\S77O"N +\.p8/)?a((Õ'i"4 {zS|8 Fk0¿_gV']5TboRPV, u <>pnY 'n{}`b6ȠB?{[i? )|Я4_oo|-ks #DsZdi_? LW.LmKw#a8e` AWs>4H5m?ŝ7 4$`HՠnN^C?>~x_~߃46vDl zMuTQEQEQEQEQEQEP?zH4=[Jԡk{;Vh.baGFYH$F ~ h5_rK}ATnuP%_&QڻOCZ{?·Nrmf9Xؐ %f;]XG'!<Ί(_c/]K5m:T=ͻ b  80=l ׇ[זzul{9E[5Wo?TU,>rڏyv:¦ǀ.!(Hp4G[k? xO2;]r9\r _o<7e/ j>nZnm-fE(}?kPk6֚cs~FGW̻ Fl.ZA K( յQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@|mZ.`x{sgB}ʧ rc0ҞĪ)_cԳFI'+਩5hyfJHZ;H.ݧϑ76 k.dZ E,pv@Ayy5~߱xg>kZ=# aF8xHXVI_A xW^[x?J4}aQs.IA0|knk_-'27FѴf5o5+pFc\}P^?? t)/ wx촛s̞a.w3jV  aF&߼F * .')(J9D9 s< [As\k``!u$$@E=f`? mo3<}@? UXv`V@p毰( ( (*H쨈 31P:hWgK[m|u:nf3>g}[Z fئk߱ω.xWrǥxoi78o@?R(i9|=& 1ۨÒ~@ąbϯ|#bߊڌ6|JԼ%qpv?yoNXH׀N`r@ TW~Ԛ ՊB#bP@! (((w>-|P{KöѬ:wZG1B[fmm ;h7/tVO4xn,GHAGR <~_v_Gý&+}B˶KFuHPt'˙;s뢊((F2ªȭ"9]̻[fĀCXP7SKƯD,˃G|_"ԛx CN+g* &k ˩kR ki9dPx"gg&eO_}#Լ-DP@;Hld!O:J56v><U]i~դߥE4YGb:+Ml%pۭ\@Q@C>(<#a[RWw c th~M;.wQ A ^phj+%|)17?W*0?dH]ͻ*T#0./R>$7_ ~O1.:8D1+t8-"NEF_`I-\>(7NY5rFӟW>8Q\/Od|ʠdfEs$w|@ou>_$#h `V;\E y⯈4kG6-Gcƿv% B1|νc]~)~מ8o'/u,}\EQ$ E0WvA@'~ º׋GHYy4X(p*sl?m?`o3U՗?hǡZ$xW’EBV[(X@C!_E>_ |&&elPO ^_ι(aM sw@Ao!wfa /&OkܰJs$sfc^EQEQEQE`π f=Z pp}U_ uy|7+Ɋx ,'m%;[̶?1@ I-chdhfPԌ;QEQE4o~qΏ{FHB2.|/_ҿhO|J~&|7YoiwK,6nQ׏?OΫR|QO}izΛv>=C&@R>7߳B!:Se@X`wh!c;Aqc=T`-ƅ=~Uۆ OmVH3}#56n%Z}zL| E~Ͽf/y$o|@oBG n5{lEL0s1$p0G?6Լ}xE[܍#L9$En|}4|,9ǖox!ӴKG*Hm2A9?Mo3O?]:\IiGy 混WO +( 0eOo@g_ xI84m:+_8zFQFi>oeWo߅~|!C;H}{ g$;`q^EQEQEQEQYzm5}.pZ97dЂt$HPw+ $(((+`/ o W>%ԡVy/cݒ;G zOܞ?Z5࿿(௿5g[=#^>y'8K,G,rI͐h+D?dg&+xuZ2"Omj %KTθE|pSj4mKunnn%BOߑp@w?tV z5duo ĤR$I$@u~6WG{_;Ǩ>t Q A"d;r63cC%6O߀L| 8u ?N.`r#XLx eO?X OgE|MynF9з@r@?-!kyaIMXx9 _uWE)Dy$uWEOc8*<G袊8iUQsCQF罳?jpx'='!C ]c-R,U6:oQEQEQEQMwf!BOV]t=N;{mkIS#6g>@QEQEQEWkOz~%xSFu@~tn9ȅ]O ]K{Sj^(4?૏x>p{gO{N0F4Q_'U..'><4i'{`>8O~!u{{L< j+'!j5O?[00uID`0Ȅ$"טk_C¶BqiR;o-!g "ŸEZ w9 FpAz?K׿g黥U3:Ɵg .NXy @e8vs jGJ𮗨]GkΉ Iq++Y;.Gۿ}!w?֍3KI׼A _ n-}[P6VG6w9 5*nöPjPƗw<@wTڥBd( ( (&챯|P.ظo>MC laM{&sQ?o]GZU܍4qψu+!//pFGV ǟ?(NGXfdәX Gil3:pC1;ׇEW Muk|y`oVemP.9PBǟ<4g}BhwZe}Vۿk lrNb9? K{ׇ|KA& f;9 TIY 'n.~ #T0HH BP[ ([_4uutE$W?tHIUXdR~_lZ=c¾,K)":W}_e_&ϋ^4G𔭮^A QvhKiX͍8A0!3Σ>Y \+HyO)}QơZWOOv^#1̽hٳ+J_|g-K#l C)!0<>~ٞ R?|qJAډوxen6V_('ou-6mUGŒVh'nx~/_UĚ|MfctAfAQ(YIdl^D]?⦕ZZ-'[FgA>?ڳ4? KmSG3 4WQo1 OFω]?eېXov_@K "i*fR9=+ȥYYee9 B abcsƺ4ߥjb}񁀠qE7?wkm(1?aѯ'/DXUhn6c8fs_x~xyc@oz,m rHUWaq"?U~de_[ᯏ n.t6:uԼg'r0xОK?h[f[;^H#@TQEx.k9!4/mN#bz_ߋ"usk>2Xԯ.%i ' e m(?T/g=E^'T;/"ee`sG+@W[O৉h~Gt[kľ+L#.3*v$*.8Q@xx qOi?h^>úh!%x`U,Y؁~'Gߢ|4we鑇uknʁ-Ï#P 2;)'U񞰱^x MZ))"̑g@Q@qb($~;gO ~7ß3i>7 \}C!=]̇>Z2d!ۯ Cs o^0S 60n5=Y-/'8se5J_և{Og_jKĚgt_P֮n;MBm# ;#[v;#\3ac4٧wߴmPo+ĉj1zrm(~pa8!KXR8c5 j`*J(((+@u珼efHl! uJ $@{~2YJoE/wƱ9$coOX}ZG}Ķ r #̈oY~?/)'kGĭ7ʵY$5XIgUԴٛ.EH2A**7mM߇̷[ ^I LߘA #K֝i3ͤ:]W:u&'Y#dt9?!WI:o&'z_tذ %ǒVS"@>bd&r?S ?q[ S.g6x?dc-_0?ञ6U~Ժ' 1khr ىx$ !Y$_n g= F|--+$KdΙ [Y̗-e'h#r?Sk?g2档ꖰiwvҌq Qч) ;ݟ/kw,Q$\ZԜ)? $=@L>w.2ͨir5.0T)7W >oChZ,#te/5sI>prn#<u_T? P^|NR> 20jPŦ%&Xe8~WR_0n n$nSHIQ ̊w?Y&iX—6h2JA Z((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((6kC,R$QO $9 d?` 0,V{;^.WR#u\UV)ٟ\(lS(kyjF.[E Ky9Pcq嘕wA\W?/ ;&_m$Ao5OFL ;U~R} I~p{K[]c ;xĺCxw} $՝4H\y Q \\9>R _߶.OXnwɟN gwm`@3~M\LUCJL?/'OK3BnCPΪiiK6G%x?ŏZxC"CfBI/hnUA??I ɥxJbcqx~}:0]iT-.u Wc ?#2JCm$D%R0'|`;D+llmW/KѼ ]{˭*IT 6{nDic k.|#7?|m\hzև4WV@A9ݹrYX}SsJ~_Gñ [wZ6\K2axn wW)Ðx0S!Wc/'6=wu1'#R_[a3L0?h:eumx#Z2Y]| @IѸF+#_|h:Mm56p~Xl8 PU|cGu7+ ]Fx# H AW+0 7i|?_\)@iP׶[ (.GO^B%M-$ .2c؃@ 訢'KEmb?ޑ~i!A4_?Ij5|~etʠ nυuσ^5U-{Q|;t|hC#9:(OgjG !l)lSwc2&gq=-kQ_9wZ$va1g#n9׈Q@7[}6b$v1 a'-C~.4mVֵ ֍qss/j p( pC +`?kڪUJ.C&b'fK+ HJ~7Hk/ |XMJe/!bk(O$B>־(k"[:N,'\mLMʫq,r xb+|E|}>]i=VV{P=2z騠(((((((HR7+w?9 A6lKx3LL]Q&>NtݒUw/$0k.:`>6ՅM|1]X\}><P+7/I|35 5C'IS$bDq;|Ş۹-/ֿϋmi$Qi:ݼFEbx[cؓq h>(((((((((+7>'Wu]fwt9f9oM7[9GCi> ?uty+ɠUK=|b'S"NIt|iԾ3/]MCW:߻2pjaP\0qCk#վ6}RUFfgGY Od]ߎ5)2x/~+lkƋi,` kv7|v<xZ(2?jOQ۰,TDVgQE\IQEngK࿋iI:t[jIdqmnj(T9= >.(춒OC [q^Oo+;r63cC%~w&mg9Jm+ ,sv:۵xrDY닕'm$o?ЯP5;:C~)յ$<R=K?Q+Kσ+D1k[;95ͱB '~?o91iJ2Fv-i[ڷis62GoXݔϗ"ky^Kۏ뚧%i-&Sy~EQE~h^/ s#O5ĶFk8,`q{rsbpe ,/_.˦SKeU^q#&q 9R<;| n_A]; _{yp葥,{X-ːxh,=~o|]xYԼM/O%֥WeneV%>Bx獠FK|D㯈0}ȳc]._1Cn>t:n4Q@[EOxFK =ז6*6" irWO| Px¿|}gz,4ZMkM,"HQ"r+n̛Tɯɺ( %iOx?Ieē#3^@Q@Q@Q@Q@Q@Q@Q@Q@Q@6^k%Gg4nmm>Uyc`)$ GmR_k:?fMk4~mĀ~xkZ<;ci66nigimhQBhUP^(((((((ÿVH'svq/ *+G?fQokQt39R>{)X^,ĸؿjU,߇|?_eW˾Un;Hcq;~ x[gcpE{Ue?_[GM-oKgRѰT=hCڃ 5Cq7ş $.COf \h,3wǯ3/R\3ßVL7I߿ %Ns89j߳/!o,u;PwT@Wk)̿L)2DڳiO|oNU!Z -5!A:4E+}VgxLml@ A  8` 1 .QƩ8{ojP*P7e%C܎sб{o ejߙmhV,20\ dd|Ev?~4xxǞ 7jqtB,v:(QQE5GD DxM|}<'-nftyo4Imo7g G㰛wφ-o"DE7]9py~-caPU ;PQE/i?'kc=ד,6y؀ $zo*.N饳HO(۔&ʌjÝ~bZZqBJҬ cP+kKK[wgrjv,(\G_DO5-FzwfX49!79>*@?.o(Zn.4rG ʐy  @]Ys_``߿H$ox▭i>jf IdeZBv 1)v;Gemmpp DE `ڿIe|UwxkSI#'Oa3澻h?G m4?0iV~-i_;Oz( ( (  Wg |GgZ .SU9-p |_e/SMK¸|i0xm+As% #nCHTI?/'j>$xRoufڎ6N `@S6 v*@O#G'Z b]AW"@T200dqrq)#|[k4/^)Iub34hfbs@&((( @~eq⇉<9kgͣKr.tݹwYO&b7?_NX79ʖ k+ ?j_')Ğ '`Xw}$ J~_Mw/얖@j: L995Lێ v▋$X跦[W*5-2oA1P.R?+-^ԭux OLp[L$r!QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEk]D?`yxCM/.›?2p}&qssM$p wv dO޿/." -񟌭D oxN#TӭYJiYfLv>4^Ch ;{[/Sl<2- Аr:[ ?o|@k/ d^_#Y CxDax隿Os㏰Ş2M/xȒ+8HmtbKɀ`@:qJw+Z ڠ98gc<]~؟Po ˯|m9̂TkȻXH |ֲ@~VZf5+VdLrHI,I9`Hϯޏ4*mj-znt|F:2FK$;1^@ـ>pMOT-%+,[#!30'AM袀 ( :o~hz&٬<fȌ}e=_9K_C SPgD!`?s:`SDfuR\\I%Կwgpw1$k.kxׅ7ZG'֚qogF$|PUOϴ_ΗyfǩFJ9u<Ć9p`1c }!}R6xn؋;NL\ ~ EPEPS~#%GFI6aQJ$ >5idQܯd)]Lްlx G8T+H?yI3'uOȀ̷߾8@_ >>xiVAr_inI>k(4O!n2=uY<-ddQ|UhO}8RV$+eKhg\^z֕iS4:<3LVS`w\l ڷŷ߳oKOxׄߌ7\-03^d߲9]k? |q[71jC- W pme@T4d9O͟txDžQ16sBO) !pzߵoֹ&?|Q*o2ncLt `avq t bočjE+k|ˆ-o(NJHp&!HaHs$?>~V?-Go|Anݤn!dϖӲf?5?vBŁ9c+*Nrr24[\{o̡у+w+O 2C|8oٯ&Vf]Mڞ˒wKj1<+¿िiZ`]2iWG隄5W0z7u<1P[Sឱ.YͥZNmt݌RN3jkKǏ >ӼCpϷ x/jNW7g,Pf]C^4>"^xº!,u-4*Fm'}Y 2^tW6.*%='Z*.^@<瓄9Ik֨R?lo' g1AerD~r^;xHe]H #p?e߳6o_nt=O۞H$ORy95Q@Q@Q@Se`vTD(I4+~4JgO+>n-.Ij.@@鐽p;Ka|3x6м9v#$179Ѻ+?gJo0 jVZHnv}>?=&<c :"hb39yyQ_ˮ~B? W7-A眝xAfkii>ŒYR/Wpʨ尼Oh}3*4gA")-@o7by#es Dx?;vGtG&U8n@?Z+o')/|Gh15K*o$>H' ~_Ek|b='Skn3aϙ zQ@Q@Q@7Tq|z4jv';"nq_ímXοK*xmud`[g<O^+{Zo~ѓh5 sՕs l /5%$?d^: Gth(Taje7sៗʊ(((((((((' 9>5h nnt߇ZRoYPFھnkJF5dm䁶=>iqܪ=@ĥQ@| UHpDSbF0, ]}1 egⶃq5vk鲺݁<H۳ĭ]hd;B|&ߎ<#Cxgz|:yݞ P2uO ";)? w o ǜZT l~RK~>Yb$n18b{2p>v~PEwcf| jٿu0M7@º[7l~;5hc¾U"+_: n(w\I+c(YD/&7u_8$u2AaY_|_?&? &ᛨ~}em.{K+y7ۥ˕IXd:XxGw2v2ڦuef4!d㪯5xKÐ?ºfk]Vqq4wf*x?LU6 z`*b5B~؟aѾ8K:5Z[pb,[#K*ži_ ^<_iISGgCPҢ7 5]+J8b"⊩g*; aլPi S"6r̽r8 [gΘ/G#ch+Cot$a͚GdB )O`~']6xwHgٚ@I$;Ɍv'G[+{,յXcH =%rN>PSB|aV%L\kq2<,zT٠<:Zjϊ韷wO ?g%?'Tq"C(Rt~*,^1֦I/-RBMҐ…T8TU [/*>] .'C!_D~f1ݴDtF=F@?R5!{KXXG׊$i۩!06da*-{tx!sFDLw, 9€OTW~rI&ۏlŶ+ +H [6y],ῂ7>mVrsG$`4FQ_O?K\};\BQ"T'/'o{-Z6hq6D2G 2Z3I WŸ;+3~.w$7Ms72 w`p%rbM}Yo 5Wkm u[$7{"GY08Fz*+;u X淖9C$ep{8"((ߏ:|8|ek:-sE1%F8Ҋb]7N%n9l;azt/WGMoZčS':+k]Y^I48፝HB_SHn_G> I>&{\a |^?0yŚծZu}rkV~^QQ qET3Q_jl_(\_=!J8e64ye9gӁhe~^LvZ'_tq "'ğ( (ʟ: ':G0[e yedžs$JC9Y\s_ٓ8|+}|i2Ǿ-{p)VTxRBXHfϿokCnj<ccU٨xSJiICHeG<_.siQv徵-m. $t$*Rq_ګ[|YfO_eZ)HQFbC8Td? to |?$njMo K]L<ȪZ;4HZ[oZ,=W,Zx#R7cZ袊(+32maMP+WkV$ 0Pf]YYr -~ _X|Udͤ*xzݲ7Kc'-63ķ }kܗI&O;l%n2 DfuR\\I%Կwgpw1$`Ev ⵆ~ W-擥y e,kBU)8f~2򺞙vBŁ9c+*Nrr25~ܑQkZGߌ_mlU=O`Qc/2`Nu?DS^G tVo&K1\}"IHzbַVQmJ67W8eWNUX)f^1韷g?'%⏄?k-kW%xW` tr) ?.]Hh ,Ȟ?;L"_ih #[>[ 2d~yvÿ>GW#1y6UsmS 6cv'_%'O&545)F&"ؚ߯n^5Y7QEWAx;=WL6ẳpᣑ[r2Js'? GkEa[/StL _K- )`G n9}h^I5x/ŷNu|׮70)~QEW^/#VP?4;]>'-ڜ[fqϔ풍HC ?OgRg[MK :sG'îT pF_unxFg4(Q Y[bjj 6G+8jO|+o wX;Q }^ |/@lRo 뚢i"H2y/7*b y_?>.KKXMcK¯;Keasv9 + ?$xsCuښJt<1ʮN3@WQ7>4xI[ڵCee >k]3b$GblI).^I~/[s\I ğ\>>ꨊ_H0n;'7Z,Icޛ}n\ԴɿwsXIBp&!J7h>gau9VVC@tQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQETsΖ:jYݎP9$W?|ao^xÖ|ڔ1}2[Q^{֟ ?"-χM %Lj,=Fkql5OUsmw2B88'q{evtm'^I|̲gI :/:#Ӯ~)j 0Wz,23n8w7gefO:k8ߵx=h'I'flt({\I8_^V|])[8bmn1E~h?aN +k$fHf*:}o679]Ɠ9h[_d'%,ӌw(5[F-=RU 0aA  q^[;׾ho>1Wvb,9v ꢊ<|U"~ڞ5/ճHw>bPa TvT:/Oqy|||f|I|e|'ЊQUy`y>oC|qZ֭|,MIL.K,]w'YT+ ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (?7O(lgW>. m,s}u ėQ_?oO !&K_x#67فfkǘ!($2]?_u/^"M&f?3X$(7򔞃vo _Y_ZN̶ig0)6O;_zXt??#< tPd}܏V.N~ds@7to"Û-={S֯@jW۰9?}If&_ӨozƯiEZ$hV)Y(Qg;κ C\B4˸uX:uwWR41\yHQʥ+wƏ~ӟu|Ajn]&B8*V5*SOSƶ]KuqL1Y$A%$O<@WKz{':!KmƉiƀ>,5*Wk/>5oAU-`AY$AUI$` v_->I4;H,,iH8GUT@+#gH]$#|JXGwG-[#,<&#b_ au~'>>kl}>Y%xn-|E|9OxQIӭYK\0(qb2 @u;^-6ӮDhK.&gc\W?d7|%Ҽ#^ #K̗WZ^kVqZxMgEIQ^/2 iSP1r\9$-,Fr00o gԎ_ǩiwj}ҼnGF @1 W7 <k=ݦ쾙zeͫ*J +k_3 D>~"ևCX1aD̀GۨQHQE|7%|;9@sjfb-350BLWyO ữ*\9'$ |Nr{_Mpw gYpZ~)gŵ  L[/  RnͶwM,<,{T\W{]mx RY=gWMDႹqc"?wqb($rǿR&O 鱪 ]jep=kI5;_MjZi'p;ry ' 8$ --\>Z[G;4qḨ9tSK67/!hnOyJO'Npp EMZ߆XЃ[ᔍ܏K&ݫ W?(Ү?GSFuKiH$QA#72D+ɹ>1Ll񌁒 =A> Gox>DGu RO0xʅ3erOcw2G?=¹AYjd۠cv%~&_GO2?c ~0#^3*U*f3sүCmmuKlw_hL.2fsufq@ɭ~k/}G[}|/_e,msFݧ=1lkm_G-vMJVԉټCZGvۓI㪊<}~1d|? I$^P|Q3ʼBd'$Hdh2CKim8ȊZ:J ձR 綷OkEe躖jcmqgtVmVY"Ã`ĀI?`.T{k6H_ZO]=B>dIo ~iL˭|W@O:$_[ljےmZw4YVJq__No,)Q ^[VkaAfX1xⶺ/^_=[nP! d2XPE~?ynLoTD+M;$j/hq(#Xm[XF[%xe]I AP(3k߳w>(;NɮeVFe"f?4_tԼG0WaG-BMJ >lfIp~2-j0 P,x,@D'!T6s׌_F?_|k\i?ۺr2^_;]T24ƩJnc޾gAq&B>[PK"Ma)~m{PW]]I[SıxCWMߘ>P~ڛrOT k1F՛?6zc~_-4~?/-_o.$1_qH([,':GO.|ova!\\,x<:Qހ4h+~'ş٣'d?xcRZ #,{Yb(T9wTPE{G~v|f lnj5H,-VW;UZK(ɯ:7rȷ"%y:R2_|n 64-fOqF#4`(lF 8<?~?/!/3ۍ?SYF̤0< 7\o6#Y-5__E8UҤuR05ŨAGn xRDY#J0ܬ97 cԿh/,sqZCw 7-DROlG@he/cƗ,π昪2][ JKOwO1 >|J>A'﮴mw÷6~kp9##*|3SdhU/؟ALUҼ_G6(ʹ$C0ı~d`?!K4zûy_1yV"28`1޿;?WZdVkipdyppTcNOWW~I/?woo ZƷ:I8`G~*W1s'WPw/5.ڪY"gؚTEP_|_?&rz cM3C:v|5-?\mEM1Ƭ˹ʫ*e0Fિuoſۧ7^W{߲{X_.KP >rF^~+S MBo<7ټq#Z2kKx[in0CW]Mf_ (Q3[|~˯aT $4TOwc^q_$[6xٞ98L?/]ҡedkm_$C_,l廷S/ \`)]l yr2G }kiZ?O%T7q7 gs(+CuwY41~9Ȗ;lK"3h嚿RP 3c|T4&tM5r~fH5+7> xXռSMB]WYu 䐶##O"V8@@8*( (Ve_ٿ~ͦ'.OU+G -̇jef\b fE*"oWl^ v?۶Y qy4W6o Id R'RƘ_t@prAR@܎8a^@qb($~+koηz/پMwݭ5?NÇ[PrSF=PO~Q> 4u.n5P)- Ws(21Xԑk7 f{6SLܺ1k)iH1d%޸_>7=K0okfu=N.d;˱$.ӀU@P0%@~,x׊5k5}K{s; 4L]SOW9E}uh(Y]J? ܪM1 eQ"uf/2jk}*ἑQdkw!/.Xd z@ֿ Џtp_L>Y!g$`P@g 2I =xw 3.{~kFu`KuW1K=̓| Exb1/'nB8PEY)JcY6~񆅹q.9so/4)vb'aaVA8~3殊NXƙq7?,erzGV)|g`lρd.u۸{ ץ1biR|nȌua> ~_>$>D5qʖҮILNR'$"coWZo#֐whZ9ɜ  5P~ mK uMgwRG.Obr3?.J~+ZYI+UY bX_xoV/^6 lKexC ?|xz&rK$䓟V~!uox^{=/e ʹ@^v ?X~_K/6c?|LAstmncOܫGh\ Hd$d%'?3si)!]Z44z|]G` 쬡l;{{tEJ"@0@-Q@7-BxoO>/k? +KUFdIv*fQ޿OW7ůnּQzei|4^R HmQd?yJ[+~~e/efꚮYHd݉0b!")WFUTz+r?_?.& .khq<,;s'Co_ş Ö g {!znd/>xi#:fmB/>ifi?L?oV-L!~x/C'.΀ ( g{y'cxya2w)홆@dGr hwxvqxHѯOF7d@w_G7_E{{=S햷g)rE+t3YivNHft+ey 8pπ?~Լ /ail>r p9XV _H~5燼 4>h >5pɑq_5[VgyrA$ ,I$y~8~^$~4k|u^x*^} (ہ**"T v( Rč7Z-ͦ_:mũἂExMoV'%W`~ݺ/ /ō ֹd!֬b58K~@8Y*H0 Z*͟]W|)^ß[Z/k;BApma0p@'i?cޛe$ n9v*UwUDP(qe+|y|nkmYUu΀?/6?_."Y%hqSm{0c@8<IJ5 1D`)h[ 8%E~oo/q0|3ƶ%TԟyNt z`[[[y i1) 0 㑀@'>Lo=c)^/"gUo3 O+s(?\ǙmXnXsm㑴` O Ku/Zx''VkjU FqwAO:Ơ^&'2AdJ{ dYa,#qV. q->! WnsdBz )ƗWn}*ҮKڇ .H$/t$HPw+ ((((((((((((((((++od&y֦76smPy׎ycʋÕZ+uPxoKrcmqiGB6r}?qwX%y-"+.S/O9=ngfR|/{~^cվھm<.Coꟴ|M޹ Mle$̺1eU@8s0Q_/_EoJR$C1:קxCtE֑c?IFYb4@8(34?B6Ƽ fbt,쟪^$3.FI,})Exg߳Out'jkOiSM&,vI‚N]\(ofU.`$,G>tW3|h~5<3x3A S5CZ5 $+-Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@WԟQ?M?6]gy~('e{~1PW_C| sU(|ݺ3pēpЧ#_PXQd~ ck6յHhT-ٕ 88_>^鳶vtccN2+O ]oCjYUe)અN@9.?u[Q>bxrH٣"90bE|=wƟi$;S^^BJ[-5K C/~=1枊?vKEg `-@|Ky]'UTiI S$/RciM~~)]7AHL𮘁ۆ^XU8Yr=A |_-Y&u`ck{4$"px~p0?7g_Ͼ,H8bIl\1OUGik|b|j*fB!fv@ 6@>TwmKp_3ShU\꿵i o~(|@3]3FN3~xc j_cy@xEr{o.I=B^Gri X\jw! 8q~B^k/\ח֣]G9 -U_Tn _[~@cB2AK/㪜ڏ ~32EhQZx:W"pX.QZK_1姶{JX4oSp6I9ͽ/ v:ik6~-`r@YR. TIj|( {EO?^g:2Wm㉭̩-e[r ہc2N?o,Ҋ߃Y&V'~ <cc{HSEL_ES'42ho"|pCZcO~y<2MOW |; zrUe1wC$ tq޺# &t xRXNH]ډI[)}t_o؃/Xu+|mCĚl D^S` !99]%A|'׼qOo ^WھQC?7$PE}AR4|ފao i|Z|VZz٥TLGa%b~?R|#i~[>$xoTмs4ql}[.Axo ag{QcO#*et&`q{)9aqPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_&nnmBxxoKBq+NA?vҾ n~>&N\2I"Ft6{6E g?M I'?1n b3 _oմwn/%ķI'x' ;b` O_྇o[cIF->>xyyg^Ӯw8 $[F2~q}Z׼-|%Dxr@6c1;IddڿZ(+ Vz񖒍ey7$5̷,yy!9A+6VxO(?߭ :Yp0"؃ ¿?ewcdVo,Q(PY,r%Iʊ(o]'᷃5okڅ6rm$/${*OJxKv߁&Z-OW6^ |ixG"ˏ-Xط~-_<ɦx?Opm,U' \lho?ğ_ |{6V3QR#ңe̒%&F #m&<+!g'KODGp,\HX}ɝRah3M??n--tЫuǍO(bZV_ɚ=.}q _#+?/q}eO2-ySy~a|_tų~-j4r&bZ$krrܱ$9|׿i~ iZxVѭ*C#cٛ;+9?Ήq $oE ?f?,OS(n[Emy 2x!ns#Ӹۂ8zJ?zU+H5Hא2RMUv,32MEQ(TU:PQEQEi5[ӟGό2+ 9UC[Oq< qp`99k'$>|;y}Ɲ>Wp捣n;NJ+bk_xd><~bor#6r[{dzƞi:Ckyii7x<Œ#he xgK/I/8v^O1~f1RɌb% '# QEh~ Ծ!:Njڅ 6XKȣ wǿ$_bO xfZؾd>sT,A|s$ֿCt6GK{;xmmȡA.NNd',i1Iߞl-<srCYO3sMM-߈|AgaYTʁ0 ?%&>#x+ |d/[6nwv~2~q~̟nw>$|@^O$Ds28E|3*w6;6/k5ٖ@ǻ8_Ji5l[k;q(-XuªV(((( #+c 4x-DP? 3l|IP:_[1rHz ]⿗o/W|Q|76pBj8*o H0ݵHO03O*K9b;8䌚+'/&xK|=j"ֵ [-;K\M4BF$(`$V|9x~7湩lkp"H3<n<N_nch_O}F%y *#*0J#U^<K :0Y|HS&-FKKX߼6v.8f2>袀 ( ( (o*&Rk-?R3%Hֵ.ꭔܤc<+ko)957+kj3&0K"HH %{|fWP$|!So5 ?c!XL&nZ=CZ6k"$j2]_j3K#3]1(g^🝧 gyغǭx.2H+<_?[_~qk{{R~tA9S,$\mlg|-Eoxڗ5dڗc7Z-۹!9s@ccKOE~D+]CWA/jV?b;V\aQHU@wԿ7^0͠~+xfWW9)3rI Tˍ wKx]%m&'=qscv'?mOfeo^-)%;C$6VQG7I-ӥ~Pq?>RÖбn73;Ā2#Wu@Q@]&^lolo"h.-I*A #W/?<a$9ɺϊS$ ͐A:`W 憿\?OJS='6qgVR[}1' [)W_Bo ׵JHt=^𭽽VwH(fb Ӡmz֕k}lk$WQ~^ёhFWqS@pO MFn#Kx_Nm}q&4dM.j#;~}EQE=J8fO :Yx▟%t\Yd`'qCY`]Mm+ `H Ytr(9 t}O5!@Š08 '?m.mO丹-~Z;4a5#|0?3,1,I&:B ddbpXk|?}@ 5~8?%~-ߋ1Z G!qw5mYs_uO y<jp_IuIR'i͹Aܪ;+y&H.Q@$|N~1Pƥ ⍰(ЧG{ptDdc g?:cMῇ  xIcXbe;,dfNT!@{_Euyx_0;Kqon۶:%pzfY1y_tI#Hu-P3.u ~x-t g>.5-oivR|, <@\AHjw^69$>Ϩ7#S&0n0s^s_߳Oa_w\<%O` XCsK<@Y3xXҭrIY+Chc?r@%Ic_߱oxzυ2W#&>j9m`NӂG5Uh&^Ni'kkV rc@+*1,@Ctߴ3 \}^\u9W9(Uyf~JX|[/oCX;]j bVt2@ d}U@Q@Q@|^qo xឹ[=UsV1}J |GFr r8tw߉~xIѼU}B];R`țvQuܼ[_ M}p𽿕ewr<Z8d<$߅>"#}C6ZxMūF0 AXb>0^emo> .澅X ;ة`ǙOώxEմ;[jK,ounȧ'x0%Hc3ֶ_hI$;Gi i#<0c9W1د8Vտj[Z/?:?g{=Vqⱝ,rpHEW_ߏ?lw>+V[ɱS43I4 ٕP;Iɭ5~̞+>;kí.mc)[KKflyy呀噹@W~B -YG b+GK}/H\.n,8hd#l˂yXЀkr;+x8Q@IEQEQEQEQEC{ci%1\[̥$E)<k_Hoهo s^]+,׶Dz}웆 7\#+((L>ubȺn=o#B1 kߌdwSy'ÿd.6P^hZ9Ǫ1@gO5W[`b[f- yW- v&s 5N|M>0Zח]aW8<+_?u { ,$–ypQ}ci%1\A(ʁǡ_lo/%oI CX>NgKk;r EPY.gOJukoDkrd\_~]_?6a=Z+'^5~#YuXϩ_ܿݷ6G>ʊOZV0#S5b tkh%n=h?iK<{SRGxWP\H"O>\+apXW/?ࠟ~xFEϋ/n/6="su#AdpWgA4'✚qu/uhl+BqbVX>~ h7aYiQ1݉ijI$O*x3&/:\zW|+f Q\Y.&`rݘWP\ſc%o/Z56"yHALb3z?&D>-!:[54 "YFIp Fz5}qJi>(캧]v3'qOۨmu?'~W8>+wIWg:Eܝ.zTQEQE[?ڋvG=)/6+Wium-+w.KmFikt)V GW @/S[ -lG-%N |P9tWgAaϿ/)O_3GI]0< @WߵG,&Fӌ^8?qgxz6^&Y.0+`1%^o?mO ]GoM<-52K._#8*aбPTè!/WE ~#cWA[[{IURsʁq5|M'?h:kv_X^$ 2@mA*H;Ǡ'r?OW5St[魯\MmY]XI~:8eTdS)b_U`@cV~ ,l#/:L/Ԭ§me'#:?M>0ZxS>F},0߼ 1ђwſi=>K__F-7Ŗ0J䡸xFH;SČyپ?K,NwmJnsrG )8<7~־s%ޏV%^÷pnT܆#{WX|Y왰W#m)<ۂ+ǿK/k/*xF#\08rC\8o ^'a%p1E8)3NF?O_{RO|\ "THHVcBhd_/cMx3I"BSA +i䂊> Ng:uxV"[z P=׹E*Ȍ+)`zkc{moWǞ ed54r F§h/ٳ N_،|YG'IrJ?{ƳYXXo\\/5x>#΃ 9vTWCymXZ/E6ssk (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((("o__/ş~ʱmך('efY)~Cx5~xho`KB_ ٍOTe@hO7/wz-%< #srI IIk{SSM^>sd䫒w+"x6֕˽WSkm,Q  )4 ~߶R_[^|Fofvbx5f83k!#p7j:|ח,, idc S7.Kj2I2|9k>ϧ^\67 Lq㍧E/+Slm`bSZEd4{z6(~|p,pp0I9ɯп /k¶7WCPvci J*]|;[e(_;ZG"}巵zbP ׏~OΤ? \ٹyKtPW5w1Gq cƗ ܉)x h`oL{A }G :*EP\{3sAh̘7c9=I5TP=[]6ONVhV(׀8Uv\(((((((((2|*K;Zo)*/'{Ru w6$]?8şSx'gQ6W+)}Œ\K|}ПQES ;giUu_ho.sty7EgoA9Q)@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ǯ?OŞ<N&Wl*6ݠrI WL|q=Axok:Yy"QFm > ^C$> i4L49jxnQ'P g?7ػ4uq"j뿲鶉<%O&х q1ɠ/=?J ?:⅔+#M+U"LXJ_7(`n.NR¹߄ ? |9 Ŧ{ºmơV xcXpuFxc'WMd]($z@1< PP_dmy}UͤKqn-H;C9K!א;uo:{M 0>8kϵ\8%>`4_ieԟTxnfG=e-Y$,^3^ހ4,znS Afi_OؗŝUfH 0q]ǵ6U珼ek:ڦ.cinI&wv!NGs@Sx>gφ寇|]\sX[]\X,(FFe9_>MF?K{kqk Ʒ=U#VbLl@0@WO "Լ^K g|?_ xwܱƠ<$I$@ߴNJ<+GFi-'8d6OM($i+_+ң٭|qUܗldWt_~ < ZYE麅K{yPc>lvh921 ~/x7^گtc`q7 ( Wo1B/be]> G _:S(_iwNvג96)]bk`? -~6{?hW-s he`x*CA(OSEuo\O HH!G9_RC㏆o+E#o=pT]`lWR|\_~?<e~/VkTHV{)Cc ~WHx=h+q$˫xKԜ ?x}['o芀 ( ( ( ( ( ( ( ( R\Κ|^go.#ɪ0sbhUQ-EvBŁ9c+*Nrr25N_(o)?|u>_|i h麅rk-ym˽’6Ec ,>qwm2 2<`N[9? j/T+xQxn[CQO (rV;Jg?d_6QOo,)ƨږ&xޚ^kiY[ggj0A8QF>B ?T:{bcUpȷC/#c{QEQEQEQEwO\~>*ykUo3Zv233( \g~*H?MMV^ FmM,֋~dv̩'ptboN~u}_FagUt`UE~@M?υPI$Ę75 9Ǿ0B?+?m''oSEcW KT! 4HvH !  ǁEPIK|a[jվ^m|z5?>5&Irw}1A'sx~PVS[\ŽU *AZ?/ُ峻+}įqi4$Ī\Q_zR??uk,>3y)o,6ɷpebrw81o8wůoٿΡKo+V_;_mGnayR9ahT?Q@Zkc*?]?ٺvZ@;kIE x6 +g^O#FM'\[$ӻvʴx7w3 9/G믊ZNo^/Hyi&yym Zw7QE~ph>o57;;k, n0pF^ ?(H| ;NQr 2~R#HϘIz ( ?k-~W96s_h+O~ė^TY$3F v?2G>O], !^M 4m{OxMu_V>e6}s+mKx!FI I>3 A! ;16ZHoԮ3qvNy?@ |ubᮗo/^foZL{ ᣀ9h?hO$|SKmK^ adc + ۜWG[$xm&ymmE|R)ʌ`~ٞOCqgmy96T<\r U.Oɢ_wS k~xM:Bv2Qy$h|ue,_#^"uKiԒ̲ A;g, yPEPW43@n` %0[dj~LXn/MփZI2_jmvp5~M#4?][_:HԘ, -o#iXp=P_xXC;oxLW1p Z_=,e1xP8ܣ0۰`EC'f)sC\,ur{߳/k,8ƨsGM3^^4jR;4B2]$0%NHX,q'|9?=&-P7 cU T(1!wS+<7g Ii}pIT\N?lkow᧎;~4A:WIaC"ta=U@2>~Ϟ8su_xS]^ +MZ3Ĉ*r 0@'do*ǏWIG|׭gހ$#ī ,H\do ') '#~ȿ֏cx"<ӕDemF$K@RKB!?-w_H[(O]4:UTMwsYSѠ|2?lY~4Դ B =O֟[Z^c$&nu oۜ|vc#ֿhsFdZt뚇>/ۤLe|b%&HV9#F~ܴPXdG$l$R2s_=}9_?ho'gmzE^WwOMP6wºڋ$_?qo#lzͤҬI|})5i1G!,v9+ÛŞgrIhNƒ %S v/%r|F |x\aVm\ŒC]xS!`&/(DW-Cđ1Xyt k$nxnp q:=;?T|)M,=6.'rA||s_~w OA3&!iii q=ɏ&CYte_hVL.:mV{VcB3_1DĨ*((((DU%G~>ti@9Xr0Q P~ПL{KP,`/RK9 Jƒ[1P7 P*6;!xRDY#J0ܬsd;Uյv& ΍3(LHԜED?M PO>QZx@Krv&x& lE# ~̟f^ڏo ßQ^jzMwz lEU[0T}) bَ>4ck5;Hú3ۨnRIId) 6Y)DFP:)QEQEQEQEQEQEQEQEW_i~%aiǍ40) FR{cf9e#R ??g/&k{F-asÎ 7B;TQ]'/G;e,u bICy4b2rֿ~l |hҒGi{Xw@8{V4t=&0cl{|5yixmc 2)'fKc5Ww? a3׬mĩ|?tm"MH3FCJiK~(|@|滫XXw!i#jp3xMs_}'\ A]O;=`c}Y'c@yOb7|SOǗif"V}BXmaK+P;dOԵ+}O6ypŠ2x $/8s ;' >OSk/PnUe<ܱ# ȿG/(?Uϊ6 xb,mkD\Eeaq!Pv.wZF-~ >NCvkt'=(z?Vwpw6X72 pryXPuCXAkoomp~TQ@Q@Q@Q@Q@Q@Q@5m߉Ve#Ԭb"|}[; .i?j M9 q__Q@?wlj4}2NcǹL'kAi6y<{MXj2&>k{|`(K#T֮t_W5H~V]sKg<1|@<{xg/<;~*51麽W A6-fcKE[18*\2F2ªȭ"9]̻[fĀC_w 7}K" VU.2 $y$ 'dɠ=;b_ ~.o<KFxq;+ëH) E<5]iEI %c%^&I$ G"1[Ydu?o蟺@5L=D?Y iJk\ɞrS_kOؗƣv隐!l.q4K21bSXQEW؏S'qowu׺m'8XTCYx@+X4JKKyF'R;h~—_M(2Cp6w pqgcbs$.Wc?ɽ|zLiί >-oHi"Vopq I h&:/"%E#¢O5/4ҵ m7V ۭγXbFAkz_|8>O4Xo.bRFbIc=_%F?e>@ o.Yls}3vAEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_ǯiua mz1ɤY2ެc*;CxC - շ;x{EɻlmVp'H($G̬EPGw '~.ϧB\?ic.vю2ޮ 2Z_ -xo}ִxg{63 A ?" _-~ ~8O|EM|ϟh//bz5l,s2 P@?j+οeڻ=_XAḷlI3F~hCF2QEQEQEQEQEQEQEQEToY=7Vc|S # p@?OExŏ&>!AUF޼чg~_n&cu qr D<+1g~Q@_|3MHز[xHTYF»ZksnW'hRs_ ~?hg4Oy>ֶ\ot6Dg6z(3giKxT$kUş]p?tΊ>)F`g W/hrL|SJ˧k63YHo "\2p{C_a78Vּ<[Z%@i!QrOݏgjׁğ |sh͍E\~W "uc㯌|GWÏk 5QucgF\e%z?*+y>Ec^,g^С^ BvZC s_߰s %+xķCkiF9|((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( ?WVycBFrֿ\dlrύ|7|7<_Ζu-Rmw1W,ǀ )}GxGXR#1q[{; |ˠ@&!'7\MMM,>%c8`|ýhWf ;SDEu[ŷGnȀ9 f9W_񾝭xOi݁>5m Vm d,FvIS,%<]yKK%o8?`;C*g#{j6ԡ|+xKNO|kiʻ2|@'xSɗQ5 ֺ{هˆ| Ê/_|U[|cC4O3Lc6G!3DGbXpp@Q@go¡*NkKFK#Py,A,LFIxJ9%?ggO. MzV/"D6P1KŁ?QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEx ?b6 ./,8H+xzta?4O1Bv[]n"A c¶]fojCU.Y&c-]'$a$)!k ?% s9oI$}"i#7NO'98_=h?AOg llH Na@/[৆1噲I$Iο&/O( ܬXغdV͵nV`T~b:W嵴vV q **j(((((((((*9KX^Ic5,jO`*J f[K/S뚮|sjmx|Vs~Xlm /SRo5aZ^'uf`+#x$:`MyP_i7_ֿMRFu${t~rG6I K4~K5xoYԼ6 *Q~eqm&l#thR2! (v_X-oVg3[{e=k2X$~T?þ6'-!O-`ԢE-"* oekylşĒ4\_ՄFL}Nx$ß.u&%T.!7,RBȇԀc'uf濽qx:w1B8{W!_엫?eow̋^SK(Bf= (𝿆m{a!|LHIpJ}'n=KOU|7@f>Du5PBo%F OC+g=8Xn F̼@W? (((((((((((((((((_?п+ ,ޤӵKDU8e< 2A ?goRc".O/ey'w ߪ(3OXo4Y7Uh.!cѰ@% ]e5 VRYXr%Y?Oh/;ό ǚ/lj,}3yl/(_E:Ơ(/?oM~_hs}O%1Mp8dbYέXM?C9_ooȱY]t"-7<|srU3S?ĻX8(Hbs989(AK1\_*gFL .y?IBFg&OfKʺ2H jZmY[uiuC< xFee< A_Z4@a|Jll7Cwy]7Vaaf!mlc)߸TPU_ZßkZ4OÚׇh/DGȡd m<%{I1^'[_ 6hQbo~???4 Gþ"aZ0LT$҂DоN k ω;  /E#Mk;`e&Q Yov}:o{d`D'z ?q +Phgu)7H=Ic9rF3VieXrȌ pAk0?p| *&?x9Wo"x[?(Om[ֳgiZ~̗6VҴS[J$GRYXAW+?)+aH"ڟڱclzJ06ɌH W?ʕz7ex3?A")hZKg"J>e3DlԬ;{1K%B0U 'S?[v]AEle@æW# }&>77#^6u$+4' ]гWu_۫n?i}ZVqCu `Bu$  et( _w7ٺ-ţ];$Fyi}<@А1%_q?[gvn3^k~ZX+p?L >i9[NOO1>q%5݅2ktӴYdG 9<]ZB߆5-BA6F؟@:u'rkG*_ŏxSMk-2mcd4dJ#/.3*'ßxKཌྷ瘖?-B)؈p.2m'ɿKدUn/? ?άƂO:53ɐLB͑T 4g ߳7S{Ėl2Rͥ"'^'?vaIeo3'xuurXCqLd }O 𶛢hpNk#A5UP+~;_?m .wnjZZ0Pzތt4EQE{jJҭdt+X}}/(cgv@ʨʿN[?&/?B?ǴTʁ XAM~ N?oK8nY!{YĩVrpە9 NPEP_ȿF %ë{?9qhiJF(eH|p?f5V %viJ9,p@&_>]i ƽmV]^bYI69<kO+5e w~.i6"IJHeil.phf<IW.8Qҿܟ$7Q;:z奉9t?*ͯ<M;ĺyqgNs.gV6m}mgZX{f\,IA /<Lz#"+/1_6mM#o ʭͼFx8m ':@Q@t_>_|Q^K=6G7$rǹ5Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@;{n~8|Yp]CF]Zb +n{肿_=O#t^7gZԾ"xzًͩگ@<sC:{{Vg+7x>$w~c)©C2HEP__no Y-<ׯeEvQyP s(rxZoA/'Bɖy Xn  vFN(/62Yq][ua;+'-2.91+ o ~'E;C|%@I/킐8dAj~ߚC&mhAuwAM NkꒂN @;cFభu-m[ɴ.7ŧoTڼH./uϏ_AjZ|]˩i.%BȸUBsEP]Ə 7~,Ьu'Ge߲gB: (((((((((+ k|Zk[|)~ƿYF-o2>#fM7w8~@ſ q_C·S4iQ>6`ckJI. |?ڧc8lH?ׅHW:κgnFUh@X&&-ɯ8>"hMq3ngA4O*9A*#:n'_8kt4b!X^5:hp{1[ᗅe[U9#ZDr)_v݉" QGnaŖQ#VGaWC}o__xpj_uB+66%,k6F{yT@Q@y 'mok5ESiWOKnnH d6U~V~ξ6kH5΍w }Sٔ8|?g+?lc:ޅuDyo8 hޏ1ĢǟFTn| ;}mF3tW yS?||fWnmym,?{c xL7f<(Xwu #}CÜ)'⿂6? <@GwD64ۆD'xhO0_k?~u<9JDG'Q_(kn%?\\q4t5۵dMC1(}]@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@7_{?kO>>ݣ—Z$!$k(X- k; wk~8#|5\3\#kypp8Ҋ(+¯|"]"?i:Tck&dr$n%(7??_?|Ff?|?|> |2΋9Yc!x|eXr>P}/G-|-:a>78--.a] R ďկ}Fd/ ՜ ۑT *?#<JYx Qu5 *](V!-l߷ |*-Tˉ،sKHQEQEQEQEQEQEQEQEQEQEQE~ßxoW|7mEb ѳ Ѿ `k? o33*?gK ߩL@wg>.~< xBIN֡ rXƭQn~_es? xKo+ +.tR.mra<S]W?"K?x?Z|5-.Csm7meyjFZ9c*%@G\5F=4|^0ut%םH`Wc9vN@kkuCh$si6g^W1inۼr REV,>(?*O +^5.+~pH,HeܵgyAM?~Z QOqEHw#1q'QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEV_o6.۽H2P;\MT -!|D+? SA|3s|ac@YA_ʗ  ֹ_{6ᘧThr_$}E(r-ԫPf3xSš_<5amp% H0Ɗ (?'7<7x%MWھîBy$ y( ( ( ( ( ( ( ( ( ( ( (9?k߅~ڧį>MⶒaLcCF"k<_}gMb\PGxM:9[r5_jWKc t x[mᯙ_ %eO7!oͤaB9Ѯ~٠;j_#Hocm\*HN"fL$I@  }XT>cQ@z}x|9s]k^(֦ loW@OR@ڷ㇅=(mY!;2FvD{3]E#:]z~3,2Cd-裂 76߰~Ϯxz%e~gw  nh]C|$SjQ+aS  ?(M~ǟݿP ~ך~$2[=LռE,n<Яk.o$C`|'j'G}b]6.Ѽ3{wcO7wBdw`aH %~"MBKVb]_MF>|osK3 _x 5<93FPjI!Jy8[h?_zGmٗ{[77_G&pz@tr@; jlXմnٳdqֿZo )jm[_t8 ?l5vH }\ۋ mgǚ|:>sX؅>]uH*â?|f_xw@9K;3 I+ y ~E* @gEQO@Q@/#|C|#[jƟi'tiou"aN׆D>F N6.=GKVa|@sxS`z W__&7uy_+j~U^'q}z%$ _k +wUԚ? q XfQevݔ灲\Z|9aC.:ƺCm+Ef^0;Prkto ,**#J˵`H17|W&Z63H nezso -]kG z഍' ygPӕcrƒ$l麀 ( ( +-f߅zgcԼi=֝lF{LL d!.JrF;6? jkV+}70UbQ7O G.@?||@о*x?Ou/ Yj:u]Z܇D%XPkb ( ( ( ( ( ( ( ( ( ( ( ( ( ( (?-l¿-[Ɵ ZGIۢky"vb]%+aO~)xKPil&uHClF+ʇrN>o< S:_|?v HSlR@eĐ`z)_Z6O67>$^i .E"HEC .S_WO)Zif>}$,NSlP{h/?i&-֟XL%3A8*A"ǟIc$-SM߅d{=lw* )b~˟7l:/O"7u脐][ dLpOPWR%¿*WI_Z DU c̆B9BBdd)FQ@g# 53 SY懩Nˡxí[:&HC37?׀l߂߉^O\Z\ ,NxBr! a|Ef^0;[U|6~2ptXcFrl&?? u[˳w۷5{>_>,q4y%Zwszsٔ?Jkoگù|lYnH#[Ө#ioOYxNa헟xSO5MVJm%wGq RDa2@ÅꟶŨ?%ǃub;h?V^m2;3⧄cjS}`UݢOo5ƽ?,-'þ*e[ju;(upF$њW8g$*L7u8d(o>7J?`F G>?(+ .atѼ,MN|ieBY-"eTc^_&0B FNR 7E,Sյle.%o*5UYE &'웦wZx/DX*^0.fKBq_hثk55k[K >uG*bKcrt *Á_c?aω&=ŗ[+Hs$0'w+uY_}5I4^O+3-_l涧rD%vB9'((_<_?N?ᆛ| ˪-d˳h#қX$?'?m~Ϳਫ਼,? T;H&ܖD і(O x>46 Q1kȯmoE[x6DbEkKk t85[|9ri~-@@6ל/l ?.2 -kX$h͠"g8Yiw2[9➿c߄6 x7H#BK[{(b$p$l?~_[n1NBnn;q,dӷ^N,iIq7vɚ#8k?C?+>R"fe}/ÒL\H J,AQ.$+1Ί%=$Y\xԛb5l2k)Nq`!~ٿm<:OaU$Gtryiÿ7#Oh|9Vc2+=#$oc ~+𽾉bkOks9l®HUQ{eGmmpp DE `ڤ(((((((((((((((Ěw4+SV,235:Ԑ({|3B־־$D=ώ^!&mvt `yo5w{z7/n5Ojڵ\\G{#43i*gQ0*@QEQE?l?H,OۥW fp;w\:gF^1o*H֠\okFz ?k$7i;ퟰV6M^{PN c9Z$j^"֮nfQԮ.53+ngmb @~< yA>s ɩ]k(:0Dl@#/_" ohhb|e}h"l u`ٮR5*AT.1VmnkR16EbhXEG J"=cZu]+vІXmԗG-$ vI.<-'/{AԬuXeP":YH 5 W*:c6]l/-b7D@7)~<-qjR-jGPm@82F{1h((((((((((o xol j% oN%' B0;dç_kugVx~5:# !Ho# hRzOoDD?CgpI m#`|Ҁ̗ybxNu,WQĖŝ TcƏx+{ OŞ 海9[fD x͑'=saCf[ K÷j6W04Vw\H7eGPJAd7v+t5e A;prKpkWⷀm+|.'1?iWZ\Dߣ]?/V ଖ#ڎ"vnwwIPΣ;ĺAw_C=WGxDo&t!%.7nv PI? DȚ5/+xM[{1*>_G k_ 7qj-]*+(T wI߉mClۑ!WS ku akG?7/+Qc L([RBPiCDSy /=ANkܿ╺>!<7_0 #\}y#p2t6?>7Z-n,5O]81OAܲ ]g?>R¯ Yi*%MB"K[<۸?%r~)~?7CˏV%dhťڢ]ʠv;pIrƛ~_>hiuA"k03k -u >,|i]%<2CH#e$ (fYckgI%f$Oߐ0<~؊HoF2Y^\_!?WqQ [BԵ5dWP ,ݛwQR qšΨ(((((((((((((((߰'ſ+Iy ]iz'hۈn{zgy%pC9 :o +P|M|,ѿַ߾qᦋ Dx$o .[|Qo&i? 4-64KӠBE!B$9Ⴒ%5{u~G4}/3rbbvyR4*AX[#pE2P'o&xzm柫i9"qk e!+nR #+ hk1?jYx>5K}CUڲd4y v!E->0xG? uMM{wAUSWmxi Z|/L""X9â((((((((((+o&)O_ jnnum}{7/<;^E#W7+"DwF"OHb tB<&'!Gق-~j3ZC ͭmʁaTA+ ZR,nu@HoF iȘű~7wkSKxR>| DŽ +U>im.)4R+Qԫr@/G/׭֟ӬQø9N A+w K u)^slunfH|mu\.?/o DcǬhwq .L}{_C2R ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( 7~įZZ7tdp:.<$FG$($m~do#j~kAc¢ ؅DPY&,_VECx_x_Æ=鱶[͛rAwPQ~` W/,g/*5\ie|5kk.(Q#,2$Fe\.>< x;X}ӮwVLҴ+O2Y\g,F09@ _.Ӽ/]V56v ,YQ<ʃ_WS )iZe%ƝKc]qnDd'27m?LO~\qpиZ7 A,~\6((((((((lʈ3&}?_,oý̯株3`/7$>NH d_kl-?Ek 14O=ӤϦ+OzX]/<"nBmj`p GV ai!V >Q`WA_e{o|p.cwF𲦀R"?,x\圐\~>#kZDڞ9 }%$mIpSc_2_jVMu0g-홉l _ҥŷ_k17jF;`^$F?tP_7{`~ڝսkǕ/zB<͂ ![jZ浨k7ړ no.k]b7`+:(cK#~?߇ <3{jma4~X\X(Vo&igS>-y_[w:c}+ !2ӝ`>P#4^HHA@nc]5;[XXb1(^4Ej]@+{@u/^髪kZv6VvpV q \@5_qM6vkxMѬLV5xxd- t$ppeqc%+bkK1 dx?ڙ761/\GwM^_ C7OF$75ܷ:v4wљ|12THnRY x|I@@_e6D?hmZђ7ǃ6JHq}*8lf 2"3|%wSl,@kD6h14-yF:RC{s_92zw=PQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE~4ٟxMjEJ>{] ܖ<@v$ɯ3]czԍukf3H9y$Sv>LJ O⦹e#\)'<''3DM[ -?[|Sn9P\c<?ԏzQ|vvb-sCK^dU>knV ; m5[piw)0+Lk{hך}k5oLDԤK_4m˰a >eQa~W;‘f$t3['0S@YVGeD@Yԓ_|`o,7n)aѝ[mj#[,_g DzeeLJ#4^jasI,+o5oiiwh?} $uJt"scPn_*OkVG#,OLe L:j 9 oK=2 K;8 1pƠ*UX(((((_rPڴ>$Y ʒ9yts ~"~vOCK}k _G7!ݸS*T%Yͺw 񏎴O3Zhz|~P<_1U~鵯g6=Qڐ %<('8o_a\:njOju[FpH ,1'ݲKq+CvY3~4f<)zlq]{^k߲ύZ4sǣi3 X0Iky?=K}7UHq stR~H8pF+#r7DgoXuQ@}v C"|"B˖ Hc"K{<:eĖfXZH#51 [UX@)5fM'omX'q㷺RO {~CxxTH7js(c: a$_tPۿw]~vڅ:>t,Zh8A-qNv vGǺΫw jW$C-ԅ,͹ I,㒪+((AGA[3y;/x¶  5l[dgFꀎK q| }@mtӤOn Ky&HY+18ǖm7;U(8͛I%+Ag?1R ?;|}og!QW8w5 (Q 7??ிtM$^"TJrp&Wp# dQEbE|_#C5 7(Xi}GBO /Ƶ\x| %ay H6j4jwk#Csߑ+.?wo-?A}7J4W*.& q=_eK⫫y`$O<66q︑Ag*(+m?ڇFed| ϩ r$ cd\s^__zOG *wɺ5+ؕ74ZtjOeSsqj<(;XPho(׌59/xQU$Ұb1U]U UxE}M~9>D_k.4L}IԊKm1h7ʛ 6b?c?=gJ =+KYr}yFvO!?6=P3ud;8+5냢^qcoMJu:{KH$UV{о~^?'x~0,ozΙ+eS8T?0uE__30Ǥ~О,Wlqֶf{&n8|s`x^1}s ќ=LY0نX!ׂ?+@Xi{oFw`a6VaSw+]MZ=M1khķ[is3@=q$r?|IFg/!3E<o?ܴO,:>;3- GgO73s&G1?j+տOZxׇ8=gGLVFgZETH5;. W@ H#$ 埵mM 9#jhW8-v[8`3kl=^ᵬ̥DjJ17J@*:UtW[;մ-m|&Fݟt֙y)ccG/߷M|t=Ѣ ʒj3"Nk%ҿ8cʹ&o!啷md2\dc3_D/hxܰm;8m|kZdzLw?7^RB|?>~~kc`?idq8,7N1~1V̰.T[eevX"=iih׼Mx2o}vH8p6Pi&^~h_> " m Lc6Y}AEGO,_ߴkצT.뺿O)m=&kg-kuYNwQ,*QHH %TPa?hc}uxZƫ_Li '`" U<5xFxRx+wFUQfUP @1n8~#@/X|>a|A+K}. sq+GĜuCl3RxZZ8um_7/o`1N[r> -zoIR:-ƛ0\6;@8,t}O5!@Š08  ( ( ( +K|94'> {Y`I$_s?c3Z A&HY-{ I@4W=ᮏ%OLX.Ve՛kڸ[`~S1.?+Y#;~{D_xt|3_3G^Fk:nn$Vw[xWFU"|rN 9#(84!?ŒHi:lmY m8x8ND/hx(o"-hO+El73 1U;JZ('Bn9LDl'ݙ,يIEr[: _4&&&UDD@[$E*:_GWÙ&,g+A8$2 GͿߵK D an`J2h u|7}fۡ-&0;H0XNq޺?lfKM3Z1I~ i{玚b_< G2'n#g<09fq$r?o7ğnZ'ro?ܴO,:hgT|vg[?wo$f8Ltc#=Eq-:ȾWLe>xn6Gqp; G V?m*G1ok$ػi3~^?lωǏZ dH,tF 09yyk$1)gF rOWߴUb_p*j~m/Hԑ6[Z dBr>Hs$OxыaxSXO#}1r1^s@w7b}3_=KėLJGacb@ma/4p `tWsO_5KC=z-0ŢoI)y8|E3Ś?i"6{_èilMe4r+e\>[(|]ۖ?QKŋA7"ӕ5{Xrj0C*{7L7r) mXͰ$?GB Fz̟OkMŽ棤j0#B( VP>^TLo'E~z>0BǸ``d} YpV__O߂>/۲OxF7n{(r & f=<Ŵ?u#i0Ih$d= C{Rm|m^"&Ul 5q~}({}V bŭaeeF y+пgφv9 SyI jCI EOtd K6Ib?`c/&?5Jgj4>p [96jL{}s^JO5$4? hVZfiGkm gl1"EW?ZDdYI(((aѼ2̫pG$r+HWpe+.ك WOajm"kLcRnSފY~~w<Ŷuln.g:O埗V, L⽟Fߵx\4]C,O̧<|e!\pzB9@Y/!KKmb@sG6ɻ9UO^03[{om!k!"_HN~lzg\6P|37,ٱ>a? ~.$kEa"!}ggu7EPeRxc<L0It٭RNHW'ld.xQ@/m t6pTksˡ;zX<7KIψ4?~ӥEy#獈5Y$cu x\ά]gu*2>^r@|EzWeҟg4v$eōPwMrm%vdypɸ 5SgWu7_ &RFmT$7lÚ$((((([@x?Rh~!xnxK'OEPw]@77KwFU`_G'c3*▥$CoWz+liaQт_'7[/4Mj)7VJ7K|ϔK#^$t[KM-O<2(tqH?5XQ[_ iVo=.<˭% g8EV8!?|P?Zj1mFY.'*Z3.pMK/~ tۃ_eY6*Ӱs H/$mĶ)LItUHcw|J8?~՟5W/; wƓrXddrjo${$[8鿴_;~8lmR)Wv<qh-ƈ1w?'gҮ Yo-є 8ې92HW߁wePxGF {mִ3؂ˍwo'⵼6jŬG7l^!PIc\y6ѐ'/mMcPr\xOLRwY0RSUC}v~&,->+ B&ܓOpTtaE⏁uElj/u+ouC4AM: v6aPEP%9J~xW[{&vm萉)hkQY0+Eft+C( WŪi鷶`Д qdp Đ>?P<:' kZ6cxW^S$%L(ޏ٣n4}3T>IO jmg)=~W߿w?xW{^~+Z6Bexj~ h 5O~T]CAbL2\ 'dђ.ze$h(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((*x{H/a..&qpF;1TI'Y;W 9~q,9SCS9~!^ˉ-KV)WC`?-7KΚT *[[RdaNJBX*?3.ig&@K$` (9 ma߇%d-Nkx:TL6vHǖPɻ5;m~7"=Г=R"a@̡#MMQEQEQEQEQEQEW___>i/N-<?HF)yQg^NG#|iro.7;fYA$@?~_ڡƏoJԇ6IT۔2k:u OW[I?Le$,vߝK`a-~z7B?x<{c9!He 'oy9'_'>4Iuk|)f.0Tg2'1|;&oō_?]xwL׿X@s,Op'~*q1'hh(Ǐښ d|\[Oi}Lly$582+¨ +?f?هOs?L? 0V0'Y]ʢF !PK|k_OK IkiZ#mþB h&lXZ)Y rH@>rm #?q ^"@/GP_}:%ifo]Hbϒ p?}6GᵴaP$p*p/;kmZQwccG۔{ a67HĝpIuhI5g߽;ED ~߱׍m>u,k eX080܅ ho#? 5b[??C 7 Uw|! Xu/|K,/5n"L@FI?o2㧌#k F: [F+%7L +@b nJ@洰$m=ͱ+@W~Ÿoڛ? xG<ȤeIb3nTq@>kHhǚL7_~%2u `Ȓ|pXLa)k G,qơQmUyc";<'+g ٭EY(?:Ckc%]wq ,@ad5櫪:]6vq<3gf<I_/ q'|Oa}7+ xBǏ9{O&;X)(p-Wm;wh/tuOxREℳyJw>R<fb*#X7?jk |#MRY>\Gr~{XMLOاOO? 6m /.vFBd9畜I*W'm{UQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE7z8\:??_ _k_g /+ǫ;e&ռNu 9{x@;7BrT 5~ WF?K<e wh2>m +w b־:|jCѬ|3c#=Ԧ`-`9uJb߄UXe7'ھ#xQՋn_*[Dd5G8y$鍠2(#?hfo#mN$P6Pmdfk9>?<gk5Mvė,6P- 9~#1&K?o=h+wuZm'^uپMљt|@$~iqKο>+[4sx6,U>S?1V{RI#0``?x7`Fe*'0YP}kP8|;/|z;\<7?ZIO)i%MN-IF@rPudYY Ks&Bte)!\9??TOU?kKZ7:O4 Iث!F!>|$=oφ]uOxRIl̳"Ƹ zbxc\u~L/AMxf@Tol\1߫xF0#)+ۑ_&?&so򮮴滪浩by9`AcHk ((((($oۓ$GkK UIi1]4e\m~o_bv=O@nb%rI[X``*PEPEPEPEhJ}j7%y$l XUFР+ӭC %,?dWXٯm>|%bϫ]#|I$pl?NJo5}jEsK$+݅EA$BNT`b׽~O?M'~> ֧˳Xb=\IpS{5zk +nG ox}:9X 5̇~9aHo ~F_|)owff&yY$7Hij9$+_#I~_}cz"=B9f >`! d:<04Ō ',FL8=sQ<S~,:ujm5"aJ0 ǜ%X?=yӼe|;;W_HGmǺ m!9@((qH5:\??_goo xek7ͷPD0NIhx_WXnat~Rہ )C(*Oᑑu?'_f/jQ6fXK+Os+Jwb] [ǟ?OM{$-BeR$^@?~__Tź3Gan/ijzn |eD9QdpBoF/-׉mnK&G4?\@Ќ#=+~& /~#=;j"mn=uQEWAM]w Œe~CHF8mp[9 ~R[I6VͶkrw0p~vy R((O_.-m)s⯉!·[*X6NvɹY:>.z XMr&m^=ܑBSs2<DRO 4QEQEQEQEQEQEQEQEj>xM>}6S,ڸP>ulCnX5߳6៌)maW]z_HǞ#98?;Y6i:ŬP>ִ<2+^W~?pokggg|C{'K+H|6+=''KRHdE r<pkb,m=~J-(BNM amܑRݶ @4Q_O<,K_/ ~ѿ 5BIoZǾ)a @ g  os/.VDnG8K[¸8' `:kqY$KTZl}V|$῏ /x?X1[8BMB*=8*A6 u^g2޹\w<Π$0?Cac լƲ4N9QUH 8"&(;' '<+^ӤPbHP!c%v^?7xM~VO|L^Oմ=v[ B7wRHwVV hWW_'̷W^ +Jn;TC,'1IM 럗46A>xEGoCiImػL4g]/|PvԼAaۖ(,b~bv2$K |^Ic3M% X0_L~^eGY0x~mfɀH@c$'B2Sw? x^-AP/nl6!y$sUT}?W(?iZI4DڐZ_ݪd1 UEd٧^i5,RXֳD [`;ʉC;0`|vw^^[|Do*$Vvfc3y&>G>:F/),1lmPϵn8w]ы3Z׉-bЇ[s]ˁ1 vHl_ xdA4!rBw3`rp_?'ğ5 I>iz< UKDFP@"2 Oq?^߇>Cx'FѬZ8"XöI%$XOZ(_*7a|PX.uk x~Y GS0'CJ!,gcg5/xPTo5=DfIFh6 Q1A+_uk_ ~xWV?M= CEj/'J9[6A16|IգX/u7|U~ۆ?gOG߲UĺσLr[OLV+Ge8BJH W{oսCM#Dt:pomA$eۛGoI"j,WvM&Kkh+@ v`8?M//x>.֧A&jWCf9 Z?HϊV":\u^@dc;r33 $2?DY(}o '!Ñ,--Ul9+}NXد~ᯇl3M=Zy奕,K1:? _|GX >\(9@zD ~((?;Z-՚/[&IF+\UA?l.MyeO^$Xԣr7xyD瑟#W SGے_ x}JPWW"x?~q4~z̗2|I -"7x4}cehv7XE~l?poRC|d\L/L om6z@"&[ujP֯W5ӟqFmOzEQEQEQEQEQEQEQEQEW~_Ś1ZlN}ciE~-X̫Ĩ#0pλS{A}>X9n<1y O(я2 <Go Ъ*rG$j#U|˵m$05@Q@xWM~ +A5-4'u#IrY_>{kFn+#*X7N m@3L?ۘ  `Č198/xPOCŋit [}WRˌ~¿C٧ ,< OEx_ƧYdac#>)yZ[x'>Ѯ57b[+no5PF+Z/)kNVԒC|:wF2tہ#.;km_3Gk|QRI $ew 0ܣ_='i+_$kVr mŚB?nN8m}5Uu":E֟y YBvHJ$PEzWYVo}pxĚhDVӼ1r;1aد5 '"Qq,R_C}DTpEtIsW>3|5ki|?+O@om ^+X8x,E~P_94:ֶd~pc*Ԧ[y!~o3#-X2N0<.4LhլV=ٔ  W̿ZDdYI+j{g.iOO7_hH]s uW JO5$?Gs¿)qkl-;Ns 71T' ,_GZh^vnaQ]\8똻`+ m??S׃,KحfKgXVrjn.nN?a\|nԼ'u4L ._9 lO cvռyqBtӵ:[HR܅$,c.BJJ_ 'aW$ѴxWTӮQgWg+r9 2 z?ྟD[ 3[jm3GFe$g۽bTUvʈIE\5?K,?)^H`3HςK? fe _dt?לCiMOND>@J%F+&z+X5?R4[Gu^RxU׮vdp}PEPEPEPEP}r~;ggZ4CI3\^iFضFۄ"o>=ػLPEPEPEPEP^Yj~Ȟf/|*4vT43HTu>5tPf~^$i|5f_<m!P&h.!ɎHd\P4?jV|pZs˶[γp2A*P I `L~(i/ طV='Koo4|[6q4XOblχQbWմYkPIqhWNdesoK͜B+m*Ma vѪjW^B:=ޏsH'w+S7/B3>FJy=H<(<[RAо# $RKy2ݬ ;;Qyjq^+H?w⿗/D{AgG=fŽo-=`0 U>?dg _|vsqxkXi)`%ԈϵRz~q_uQE~_>Kuem3Rg s:A㜆'v9>2jKOV>A+c<  |s| *:Tf[dkĭeZD?υ/^aZrЈl.#3I@m>AQ@e,xn Wk6]Kiw.3\]T#-8 jvׇ|Gc$TGPT@տE,OC|;~xicui>h 0!bHKrƣdK ҟ"p)%q&+1O@C{¿Gk6_[G ^Cw`c;$RKF빭!kx, Tp]A$/QYBbxOi~'|'mkFkxͪZ(u`T"wP@v;@~E~~?'$|HVӠFuyo-cmc F# ~O}CZ߃mc?eU2I2g~QxnjgZg(Rn&+w`n'pU`_ї[wƾǏËKxšUy\m\hBB|6 +?`_*O(7A'|GG>)-ơ/4vҺ|,R@07˙c~?[zuȼ߱ o@ոIhر;RISƫ>ܟe?)lU>qog#g{V,b'v8nO?/ZmKx]D:0qZp$ :@?f_=[៌m %"֭xTq^9>8xd~1 |U|5ZEfdW2KeI q0ٴmebj˟\/S’||8tfvѵ  Hnm!O  7Y#C#ܬ ٧ B~Ķv/_ᢲkubyQ+ y]qrP `6|6Àe:EFfB* @7aʟz~*¾$ةnx˸F`mW9}E6)VxDetpYNCЃN(((((87mP>?#kR*U@#P[>v7gdn!FԼ6VQ~{osl#wY"`2)!@?~E|sSk,y*2ƪ1=bK: 'ig5/~+m]"'Q4 X8/W$}Oh |wuhvi6ɲH#P( ( ( ( ( ֺq{}uoggiM<#Qfc$ટ_KPo|Mxɶ(im8[T +$6R.)xi>^h<#-@Q:^fb 5 (R]OE_Y}2m?m#Wudϐw$B.?o/=>=xc{C D\r\JBڽk 6GtSi-RҴSmqH73`m#laLWeG_^5&:i} ,P,h1EEF8 )_/|}?K75>I9r@|J~6>xr]յ6OWR(Sq%=B.!Oe> ?m/>9NZ4"Nl_*6H@^vo3%<#1,5vyTy)dekx aX}ut ׏K&=q_ KzoC?a8ng5)a߉'`@OQА+&G_S#.u~{-xYG#a8s.UU|f_ڿ㿅'K]K0N9DIljv Us?_%K7Bk8aϔm{QdQ-Qyڊ$xoKᴵO?ooږ&|V^/툑ؾ-e X)8%O_F;u߈3# [D`G?O_)/o>ԡ7>coUUY-q#Ueဲ8lMm}>X G (ª( :&f4_, qvLmD1ya8=k2 :/o) O2+yof+̬,M(#Ys/Czˣ0G~j- I<G@F/c? C i~ #71i/xOib0kftkO vo )mmo B((WPpxZo|?mX}_dȑٰ$*r2T@(va T<-cq,a@оuˏ,qϷN2"⿉&;s R6>tKkqI3F?5<{|Z]ZFu_υY'yLHgV=I#sTId~,xK6>,X22Ϣhż-1R2ڟ%`~6׉t|30 _=J6m,_,2 p0=TaFT 0@ Kk{[׮&H~.[W!@73*da@@v .fOըwmOe*E,Jz,pyckƍkč{2xZAqu3]W۷qWE%onjOi>^@g-=)q{̓m-e`XJ ~` tKK?h/+>6ZmQMl_:@8 KLtE}++;hp4QUPEPEPEPEPEPE|hkf--g&[|/OB]Z+m-* ?t~i/ I{`2|=1_O|ÿe/K~,XIRFWo~ԩß5qŪ Þ9NW_]~?[ڃ4#o|`Cz&8մ7k0BOr ?*+KluY-t ᜚~DĞc4 ۑsLs9Nbd(7K&B] ɶh |9d(((g9~?HX#ú30-[I1N$$u_⒉όM`~f#c#z@οyqMzVmBP[;Hp%Xs9z(rol\*(l%YGF{>nb5<8)‚QZ&]#QUO  p7 ?=cO?4kM Wwm}gkp1~:C$P4]Y \Y4A n. q22$ ?IK=Ch$X8[#;>&J@25@: EP_GSj;ETdYNr(h'w_Ưc7Ri#VOh,Y[2ܮu ƿoQ 8|V7#\4XXq@s_-x~~ko[cMѣyKok!p@veEb)lv???ju6+|?*2ؕ餲vv5 d~1KY/_rF.P˻$<6# GQEQEQEQEQEW&-OIܺa4&xhH̚|v͞$44Q[Ns]JOm{q)9W՗vsw{O!$ x'l6(ܟ,d_ _+ gwd7>a E[ۤW6*F?C*PE_x]V8iGa#ApF\8 ?W퐚}ֵ{>l~/-mtW3R w(߁<.O Fd QKO|Fաmct+ s"dg(,v ((U_+g/*ǘ|IIg/ˠxZvk-2՝p<'KٟWVOCOǓqĝR<۶2NNkBsUbcF00q6Dg K&$7QEWo۷Z7/u_jRMSKs1a (iX7p?zgG~7f s1hvL6tAyH9W@?JXxᗀ|UJirV_4ʟBN,c@cXO$]E~1.)6vC)xԫLvBHOó ?D'7&|NA#][ZGݷ#qc G_$ilNw2%ߵۭ|B/d|6PHR,k8$ o#] Ǫivk+MR.n%(W2XRp\PEt7~#Ҽ?kmoehk8w;3('9?jgg(ioimrZLD}^a]ܐcW|7/(ֽoO0OQo}e&)xݍ,$v8 2O;()gؓL^BT^s7=(7$><ڭy,sp0Uayٟ'K9&g|mXlǛx~7mrFtI .xE9 A~?(fچI?z4&cl~I屇q2k3 x)>ş u  IE2mpb 2=U@no6tA/ YimIV Wih@ % .GZvBŁ9c+*Nrr24N+AsKla>s]訍ir\$.U& VPH~*~W_ |mxGRm8k;1>TN$F8#?5zWY8#"> Lfit{<9nKX1?'< Mw|7<ȋ6@l2ZK6`Aݙ!#$k["[ZMD[]LAqrIVR:H5J.o$ocS/JeF1 .<ҍi1by@Uc$l@z f?QY\ i"-[Cv猶Bdn h??|5]*\k%&GSV~7:-^"-ׄ+f;}7!³c_KX-d4Dpx P!.l]o^Fґ\rT*^Kr@?6k NKuFEXc#i}c`~֕ n-9t Y&Y[΋koBh⢿6o-k~4!=i[ &hH$QXV` !*j(' -ҿ?-[YåORmx ɝ@v> Jy]cᇍo N5[ B6MikEo<9Zj}w3%ŵc #U AV ?_$o[yb܀#'@e'3xlwZx.x[;1 /$\x.W_Gؠ?? @:Xug-=%'ccx뿵g~?O>%kE< kS!?뼈!ӰTa@7PJ^sbEP_ TXhwN}4$gfh~OcD_j:Wÿj u ]'D%G !y$v<URI= c@?੿nXx<ʥMFV>۾5,v &7fiZI$EY,žfww Ǣ(+CY,_{z߆ nuMkZHMHwXٶ4c{Cd )|z?%oT+'nkx^2!@%QsAt;?xO6p˻1,ij3$MI7OfZ//NG +ܜr,fbY$먢 (  dGG11iMݡi8De^CMqs4veYX*D2Y$!J~soc9%Gt0?svA8 X!~y_'Oj"j$9 'I2?sdcYGM95om4{=7ß <3 }w(Q\&qA -?=Þ'm?ޫGMwTK?x-&lGyHmϰ~}@W_7Q~z~ះ#~U|CɎlP|ۉ R07 _҇]|)z~xn?~+^IzGy%oGhC)'zߴGez?>X?"OZM{tl:228bƿ/!WoV 7ap? ÿ}h:/?Fauk(-.x '(o(uCLL<={'$.&kLy5< ?d/ j^h[?WUܯ'nޣnP>QE']^ 5_ γKjXClʞLrXd`H}3H|l~Ξ=J=S^,[02[?ݖP>H7^̇_]~[?~8Q-cP "2$J$nÀT^.W7{s1H1f߽޵>կ$A\]Lm8g+;=?>մ]KKԠKKYVh.u #!8 W_rFo [O"6g_wmq|/\H[: $ Fy^EecZ/-Et"[䞈'ֵ( (>!?h?ٷڼW YCiPqo"A8r%cj8k{ѿ>—y3}Zdٰ62&O)@_eIK _2k&nGE ?wos`j3Q=ċV⦼k+> i{ M~EPEPc~ϿVw?4?rR3gpA̐~0#濦t;xO,R(taTچVk[c)rȌ*GpA*j(~w?N(ď4:>d`.t69b7͓Ȝsɯ`פО5_M~hwgI$/Ŀ|Y=BGE{õ涸D 9ˏV9[y?h~?íWOFǰR:5I ;Sݏ#D?k=GzDhK?Zc;_A[5ޥ9&HoQ"DR &6tm ~!iKx_tMm vMtlp2?{3IuVv%Հܠ1mo<i ⧀o4B<vLq=q<0+fh?~~ʗ^~_CZ|+ 90LW Pz|aW_lj<-3P<7v^cui2͌2Y5T?d:3;ӼtteاԬLpx3Y X,uænǿ&αe3*?n-[?n$3&?< Z *ݿ M̺vd/o:Y9Gh]H?O auO?!H-!f$6;X=zB_ٯ> wuCb$O;lf9$v=\ۃ K?e Y|ke7^u(i63sg`3NG@wEt_< 3S$uo֥7Skk6eG@~18"+GVOⳏQ|3ibi# KVtRwtLbEVT_jcآg4dp,2c"DĀn{U%<+W~? L|Dt0_SY"^o圐I©## t)OCtmoÐNK<-H9蒿?o̍Gk#兴FΧ$xt^PTQEQEQEQEQEs>h&<;:}+RC%żјSUc_?ֿ`oG=rf7Img9~b{K`ۺld_8___fe4;[S+,A9믲~bg&ŦG#cob{4_8e9|Ĩ5z8|ϗIdơhgJ2vn BO/ i0ٍBݍ#un8ǂHW/_u55]ޛ[4o)B⿁şxBEծ 4[$Lm۝5#*O-4bm|mUUl1 5J3[UG-']||M z_4Qr~fdySp pPEP_hOSW/h[D1C99W{3_٫wƚΓm"HoANpv _fe'ƞ#?InB 8 Xd~Ŀg$x Nf VY${dUnDp7 _'=??YO[$."K8Vn# rBH"2໿m1b~?xR[hS.]?tQؐ6k}ߺWQEoIS~M>6uQ߁ȅ+]A Y N՛o˿^*/Ӄʴvq>e݁@}x"Wx:n"Pa[ی fldgjdzN?k/wIi̞&MOw&B`+,r͉OjS6.KX1'$Ÿ%F?Owę_OXvw޼WmG?k==c 渎dޓ+X0ɂ c=P >i%]N J c3g /#!.|E7I`~g8<~I@mWXi|3'Pi"sj) _nI^>&Zsu"k7V!\̋.;Ls|4߾PeZ,΍jٿ{ 85;#3qoxkOxrr27i׮2[%P7 7"us/$ E[x 7y R:^_}I0fihui4l4BjGkv$2i!yobsdO=k^{7WPo1tt;[^l%p߬?OW䴱7þ&*x=@;#3rF!>Ϣ$PCPEPEPEPEPs5@Щ)Y$$f~?џ+#W4\<%8d}ƒݓ! $m!2],XYL-Wlg(9zKO\x>wO~(+ l%& psĸ벿 َ/N E|1: '1t*'<|@Z~<.fWu&[yUFStjʑP?ώ',G]] mhT^iF+Y1JU)e?]WiG Vy|զ+2qfO#$odž&\,_;}BNڗj8p|/ŵ~_oٷ_ <}Cj+ % ,m=ʜۋ+o?G$Z.\Z^ֲŸc63]Y5\miḎy< WG*_ɼv9;c( #?>e k d Im8|a} |ڦi5q.m=9u>ZUV<?.ό.#쓭72~?BĮ7mHJ8 jZ Td$lV\)j((((5-6X,-Ẵ ?*73տ,Ѽ]l4D7p>KB Eܯ㢾K?߷߆]^,>)Vc{d\\l^ bp"?**++u+(n-KIQC)A֥((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( nS/>b%to:~Va;+0$hA?0U/5?oX,'l ]Q^H8JȎprcEP?mzH$B^jlm+lpq dꢾ#|`H_L7q1wH1cr>((((/_Z^]Jk)g݈ IT=6 K;HyAPƠ;1TI'5 ԵO?ޭH#fվ!d`('L@`3OϟpW_vXCT~ /$eHag!5rZ^j֫3O<=ff<'q$rFM|C/⏅|=6mS~/`ѴVFeY*UrO@#7]jR h/tPEuO_Zx<Lmcvӏ3+mc$WMzEngxkHKt|V1\mز2G Wۓ(xNj&U|,-cǙ4k/ A\i?ъ.uvֱ`{n?׊!x$^so-į18]čNx-gx3O7Z/6u #0u#P<OsĚnSZy-uV&Qyv$ne8lft^o:O-?a.} IG\ f9)$r_^9?uυ??_/[ K_$9AN@U;b m# RڿxWVPI"ڷ @ L?"SQg{漼idԤvieiK$dH`JrX0.?5xKxWե0:1 nC)5GeZ "|G[x &Iesk 1gl*I#[ 3|'u_rMBSM?Gvwik6I`3w}M2L$[!^e KImnga`)OOX/^ G%# t}=KlBWI1cDJ(C G FxƷsQmomn|Ԝ `sht8 ~klSj,0@㤌U~^s`~x?sů=|uoc{?xmy+kAN `ؿl~>c]*n21y6~,@$39t&?*k+Re_4e@ܑ*({*OOTWɟU,O¯$O_&=V U՝A9ȷ 0fpFxP  A 8!u[r)`oω?j5Lcd+Xcl0UNr2s,@য়n7[I&a$:=~k ǡ 1btW~ȿߋm_oD]cž)-mj%į ]*Ws`?^ ~2JφtK ZiuFks"8Ql7k#W+T#"$zdY uHRpL{ %쓡3q]B>ٯk&y"rH$EQEQEQETw71[4G 0ww`I$) gBZ&KemRpW#d{&NkӐ&O-AQEo;ZҴY.]-c/_K"*!;(ݐr0kռ!xb[K#y2\ں p7*Hr n/4|"?l 2:kxx"i}HmM[pibԺPx^lyb[-=:xֈ * p4Q_@O![&⥼ .&nc\j=:39>@V2@xgWÝ gg`F̓NI$k?8o 3o6gL>l̐9nm_Xn=GR}wymkEIJ*!;QyQ@|8a⏋>6~߈c]DNi DBci!r_~?jIOtOu"w$/<6Uq$`2?3O ƏF#l ;/nS~W?7KfMG}J2G{e{>ҡLiHC}{?!'uMo:֖i[o]l(A9a 8>i6 @Pxs^Hb\%ٷsKgh//ȴ/_Y=R@Z86{DE*;ܧ̏rl`0>&:_h ~)xmvBdp^A‘~Z?__ m| L.m_rk`,9ᮻ{6|Bÿk ״FxHލ|*@?+ wh| OCc=mŚ/\m/6s539ȌkA|WZjZ]ij]̳Aq *G A QEk|lKGǝ"ͯ뺇BE@o8R U1?y[ȣw- 摟m߁r0E_CVѴnRI.teO&;IJ;.܅H8 s,j[G L7xvR(z {_)G<_ Bew8뚄mq9񇅃ϒI+dR.Aϝ+c$?<71x $2'ojqynhnI<.I zgfj?I/"'$nKFUۜv%85IO}aI3m;$04q6u\d x Q?ڮ׌6zEŽF_#(K|K-x̂O꺌TyK)mv)?GE5[tkc=eg94韲#S|0PZ:F$2N%#,pVNT?ho>$V~ ;R;[i'b}C_ſK৿},W<3/B6mܓERqƃC// 庻V7PɒAB,?xo:\6n c ~Wğq¤^bѼizM3~yotc8ds7?: ^4 _>>oʁ`zׇIJoeWw:S7PO~|Hοok/HsC8Z4{xgVrXjZuBH/ mda;A 53c^$Wjš6t?Igmd7c-Y%IpF.?JZt;| /X;FM,oO8a  XZ##ÿ|%4{E4Pʚ}ͣ,%F(F9qk S+k+|NSo/SѤS/_.T8Sh=ּ!YzjNG}$8*|ڤCgtߵs;|F=SŚ1yX$FdP<"9l)ÚN:Nƥs GVwTX?%rz lc ִoߴvo7JsW*Eh:\HDgl:6?"Fh]6FڤL|rBI!eO +iO Op9,z$Q ,@8O)7&O>.>?is9Y5B@|T'a`Wcš.?(~2`w0兮/zG]@w.ox7FO%frXU¨z )}φ 7+2zp~5#vZ|;=&߁#äxgš|:^g݂*'%$O&g2$+/bǎ-0u "mTS1>(߶$Ǐ"<>pYy?y=5U'o_B0,s(1Yys'Ϗ_t&xUaVeX8dw *sl܀@RkTF~Ƌ:>1]kGѣDḽ\nHH2ʊ03l$ S[τ(n"ѷ>i.|d4k.z*((+'^ ~%x#YkϦ?ݸ6D>̌GZP'}&):sۨYJeʐ$;K`j?_%t_&-6K?CnB>n2Nkg,O\Ҟ6 cJq'w/AoxK; m!wl@B& Wu/o؟EO^ 0CPu6Jc"+7r3?+ki}:d?@i1m4ǨOj=c_\xSK"=CCYU㹱%.2tyW]~f/:-=]>:d26:pW~ϟn>!R!X[Hёۚe xP|w1~j~h5:Dwb@&_8W{]BHo,B-o ;!h!;PYH??ਾ#- O'}{}ͷMĠ 2傕=Q[,֭t*KKXⵋ򈊈N;*wd m3>=c>$|h}K˦I/],\+qmiUw,O eZ=7)[8Y˴Y',G)r#P9?dO? 'GzjX,,dSI5Q@|? ;1]V[}kZ=9n@w=R-?AoM;x$3;6|6XR~iehAS_(+sƿj_#Crm+Hv rvs#c<|i]iďZܭ6Dc-(XmT@ptQ@Q@~>:~ xm_^Zkw%q).ekeHvRUmT0$kq_+yh[ V9cqʂonukrgy9H G~Rѿ ;Ugx9OϭƠ 0E;tS@l/84?W6m&lUB! )~%.g yrx2~%|;E\Vx=Ǿr_fg4gc[mJ0I XD9PO2t%~vh=i7"xw>cnKiQ"`o[F.WrUL3l~οÿ^ Ȓ&zWg#wP_!^ Cwn#(q='G17u]*_Moq s5̾L(z_L~ǟZs$k(|kCGN0t@ #HnLF6ʴW y ëx7/["հrSt ?0X^K>TFx̫^KؐC*Ukj&gxGQgkK_~$$Q~4!?~8V|GmWN$}TFD&ѻp\09_G 9g'ZOur-χ){Y@ϧ\m!9 # o|Nvi?o G'lX`B 2ˀ?U/JQwM6y1s+do$9I-0̄οiGgJ+'NL[xY區4LR1/~rw9 ޡxK; WpBȄ2wWRcq땯_,oK u^x@[ψ5[A+-ŨF)q*7*8P2)i8uK¾/eYjk(I:7U3V@VW8?qzu6ߍhi'P|"ĕrMW#!:u jZyu|]Z]<7S#YceT!dG?tꢿ ?8gOҾ |n-,~0GM[˂F B IP2+#x=_Yc>vzʲYHee@5H)?j{f>W!]Co1\"Ð$Y_WC'\׾uvģZ%ǣ)E/g'5O4^lmm^[3r C)nE~.i/ R{5{8ur{IUr^) v%Hd?/'X_OK whvk.F 2 m_d~񎪱'sҳuJ,J@5إYYee9 B : l,:2uDbo|bc2%E&? ^wW?<v0+CMc&Ҭ֒X6q E* GQ_?ͮ/~1kq|UvNGe*\\ H1F".s\(Rgƺ?;tk@QȲG"oBKK0,~."'޶W|9D\^IWFI;p+#y70lhIu QE6{G'+Jr3bd]%~&֦yxɩHIv<9#qba]Wnlgkᾋyc/r1Ռ9t9rbF@#z?ˏ 7Mݩ@yWBҝr+ ^gL=n'& ~ږ?c ԡ>,jN6ɑr G?p x\n xFOE8CԺ<HeRAH,k 4xnq+=&ya+w ԰˄I/*x`? n}6-t&+;Hj{~?ࡾ$X_:2)i!W2KrI55E (c]WS5œLv?n)Į"I @G=abK߈7w= -|ʤCy/axP%&K,mcV7JFI%c;wčs⷏5_VֵkGPinrJX`r>R| |[P|Lgÿ 0Fnne`P[,@\\⾰J~,VU 斗Ui6/]2Fa1`YOQ/g$1Zv8#Ե^" vmb$Q̈́P@?O= j[]!w'?ؚkS?y};bnC%~ _>;)FR%(K:n7 q}<7C [$& 5!<|e~3犼YIAej$Ha_wdcym~,oQtiuә?Ej%eej@pxGeE~~ECK]xc[K]Ln2|ll g+,yoPGxU_[;$`WK8"$G _'8=a ϊ|W_E'$lV ڡi]_گջ_Ghgs] CaJyP/DIV~??M I'?1n b3S)-xRk0agZ:kƊQ1~..On_Ep9$|?-j?fxOI7xOTAqψcM^&T*ɧ G$Dq+>";if$$f ]]M<ߴGcǨٞA R?( :c8>&G~MmCG\6ZÒHc\28'x33dٺϊ)6lam⿴)%~_P89$oBlo "S|ѠD+iH-ĒN ׊ٿPPizC%Vnm"촽B݊KXY2K!q 1 APʿ.wrm|CϣNc%dfENw_? ơ Wt+6>yk2HРV)\ 9Z( >|dCK~4䵔s񷒌 :;,?o!oVθ.W1EDno&66}__Ye Jcouvּ/p[73N(oX ?'(Ὴ~ b3 H\q8aáG\@\?~ j^ Փe֝[цyWu!5@c F?c|@x?ᗄNF|1onw rY9vQ@Q@Q@[m~̺o#EYt)f&gC2$PW>$j^֭nm5Nԭ 2K $nW]c1=FI _޵+v߳/m#iCU*#p10/vp WH Ź= ^E[@dfG؏3_>{Tt:NW$.8XpRڹ( 5֡jv[Ie{k:oA5wpzkԼ9go5ïyσu2-VK6--bmǫ_*s?TKYm큼5Iq Ep;]љrh~6+:,q 떡Eܦb ͸#*;F[[|q&k#GC6豓oZaճIC| ?7kP&l/`k׏3c4k}^3E嘄-&9xF I4B6r.$HYc:a~S?O yTc VrZMT<]DptEP*ϓ(gW;YWJ)F .,|OmAco$ NxjG& #_? ?vxN$q19QL3'Gef?gW]j-gúr8[>pmqId' ؂T}R?WJ[C$sF2Mi"/.0*r)+WM?Kk^Fma7,\ X8aHbeT:OvO|5ֵ[x!Fc+XYwᖱƗFh4}Hl2ʖ©r ;nxݦAt6e Vm6r7^wBx;!>Э|" ZcZp^Ff22KH9UxR|+g\jޏܻ1c\$|%~ԟY߃Gh> )Þ<[P]sq]@ŝ_1܃#J O(E[9 K1q῅~|RbY!I$mא"ߝ F獴ouQKINEabBaj-aHE8*"p'l<#|ïh>DKY$ijI95P𽟁Vk&|B[[\/M&I,NK ?Wܟrw5YWt,!BbӒWBŵ@i#=qx:M=A,oXdu@rR,wh2I WUQEQEQEQEQEQ/O?bO_ 5oL4IU6o$Okh>zu Lor"%9+ a3BX59~ʟVel!#F4Uc Ⱥ8+q@S~M2DXfo$BJvd67+!;OUIf{h"st)O ܧ,9?/4\?zN $MhDhYPAn/x^@',EPy1 ڵ|IJ@^LN@>1ujV:q;y㾷!'#` T)<He+X*ëYy  zW+_3 %E|A R~<&Ӡ#w =v(8,1mE#RTӭ.و<$k?> 4tǙ ۮ[#`Ke.'vy}N>4V?H_ƻ[Ğ559p;Ekm \~^q~~?tsp}ithW9 H,T(X {+VIBMGRa̷31g!I$9Sm~]'T[o|Y_jQ,i6 y* 3b4[}3JԬAI"YG$BiYGʁ 6|. a%m>5u{%n״m?ֶ&wL:'#$joƘ~g k/UDIsS-c^1Î[4QEQQçKqq,p $F ,I9ɯ+__ٹuo??qnij'4cd`n\q?Nk/Kw5?"~'?j35[Mơ&\1FBDƊ@1~/xZ׋GH6K{4XB*q\8>~<]xZҙMsn<zt|U?lK> +;d ؎:D#1$@tW:Ņx.b[d5ikd䳍TnQl6g# ><؟ɵ-/ Rx4y*] |f?> x7 D,f>]$rC/2 [GĚLzz?an9ܦ`Y\ m8TP1o2:>zEP:toC,jC+#5g u^/ۼx'4 J(A#YoCk?u Mfyt»z*,=&G^ ~"xOQu.Z5{wg9VR @ [5˿,AHfqe bsYHWoZOtLյ %64ȑv-?t<]wφn)[UVQ ż:![ny$5x' %h?Wc{ƞ8].|1EGL%R>XIb -Z?^]̖z2A= <|Tw<)Pڟ_y[WW$co G4*>e6,F\qk'>,@~@O]ݶO){L :"y喊b:Muo}cyoso )ate$2AVkin<0|AmoIx9Ӽ%otb|v?߁AH_J/8;A?i#ݡ{+ .s򀲀 hs@yQEQEQEW~ܟoً |qnϣجWQ"ƗrnF  0>E_;O'A|/k4I'Zӛp7PG-e(1<"-7VOٽ~$x^)<#?f涘͵Cu(]y\3OٛFZ=<][ϲjW` ?:22Bke@6c߰|R{aòy"x/ccklAEX g|a'Ff{%Ɖu ^LL ue_½s3<}n~"5n42( k]Z,L8d8JHA^%<=|m\++=e+P絹.>S^#v.x;+ XmDׄ.{68E|W*[* ~2*׿gՓ ?7>R??/o umKOUP2/t;0s2J'ɿ_~(h=:;_ IoXSWu~?m|eƗ mB-l"}7 铂+]sq|^[Ω߇,5m?F#$RXgZ$aVGNO>oui rWr0@ pW앦|z4ofYW NH#7Y?h[Z֓zkp>˨@P̸U[Y]>Oۏ8|-} $Wv4r/ +# u-~_WO6Ir"_27#a|ܞ Hֵm/46VZ5.>sïP94xGTu:Og݂4E xLC+p:6Ir QzR_4-Rԭg g7Urc6¾< c>4;4Wĉ:͜~3㡊vhsFʼ:5~ePctƾmبo&co(7GN/eRe ,r8% 0NRǐK cv7:Ë ^?4K ma3m~VF _xo-?]/rU*mP#v5RqkgůW& Vt99} ޟڃo{?x᧍lFiױxXtodSڀ? to ,**#J˵`H1~ٟ߈?aړ "P#i ]JZH&(Hy6 Q_g]luĎ!8–fbppq_KR'\Zođ9f+awm 9< t5_^do)_]YCYνLgL u"7Ugp&d8'&Cߟ2c`V~ʶen@$p>[,r Gˀ@tQEQEQEQE]K=տf:h3Ik=fn|E}q ~PTZO9 71v+[Koo4n} K?J>Lph?-o;ZҴY.]-c/_K"*!;(ݐr>*|]}%1>s_P@$->_J3mbK$O2r9?,*2q8_3 #Z~_i"䣐dkA1" /oo''Ǟ:Śh>Cͪ\,lA$68?M I'?1n b3dk#~tzfe1Q@$㓎;+x8Q@_O^o 񮏮/[K_h@b2I J˙>7񿍵 !Xxtk6\fg n8Po6.۽H2P;_aɓ oV_o.#%hdEVCy"*og _ y s5GX[xKE_i0&38f-s $mWmƀ d H<n n`G{_}n nISf-U[aKeg/4[5nJj) PK ;Y/տ>p`5ԃB$b ~ڲWĿ~[IgF/ <|ʯnciaRU I;WD(KIKS;A%L Rb'nNXW*~.cHwx磤OaDgee8+d܏#]'t7wMd?C`#jSx?HOE&_cIFWipƠ #,h p?`__oh~ʨ(}Y˱z|C͟4cP&e@@K jx‰ ?h=@{?AwHo^*q{x,Ny̫<~m_Y=յ{DqDfb濕/v m VVk6Bl2^y@1ߴWs>'|Iό̒ cXH+ qm(EES?_-Ŷ7V>4 `=3%~bG ;8?kQ Xh׌I{- CCfR|sR1'=hUߌ.æjc+[X̷RP*$p$J ?kώzxoN`F 7s܃ȴW醕D3/cq"~'2F1$y'< y??7eq}|feo I45Q䴒g8#@73 [ mMx$ //}4mw^k9X3[ĎG̒39)<%xSf.o1ѭmፀ;T!~QXtQ??Ro8[(u[1=GNlZ9.1\J6 Va{  @YmWZ֜G(_rh[C 2y~Y|!M-&ᙥ;oœ72ѷ.*9ߊ [ 7TT)q%Yژ8DdgWk[K}m Ky,3qd|uW~3z?o#/9jp#<' Eg־fu1-[oageb+ 09/ث7)K#⧄Z8 %Ҭʖ&heYk&|?a/:XEɨ;X`m#ϼpxSJ =$1~\fn],s\F9)V cYQkP7o^IymN4B=в<E,lC+O oX~Zß͔N|T.cw@_iNܖqMh:rm\ZxKdc#ʯ? [ؙ8+(?5Gez}ºǗn3u~ڟfL?j?5_Q?ڧM6FMJswFܜ~?((((((Eoro!~49#sm$'?^Q@h5]V&Ov+ ? !vƲ\UKOy3C`sr$ \LPk! XF>R'# T_ڶkf ~'j>&-}0Vʤc!~߿o'-.5O?<WKX!"Mnq*j\RO;Qh6F;N]x^nAxeR G-1x>PERoRYXA">J׾ơx÷,jfdQc9<fR+%>"kW6m0ƬTuXY ~SV??arsrsȯZ6khcAQDR$TREPEPEPoiwZ]F9YOH$x yY[7)֟AUGbҲU9 4no*?_l_}7_~ x>(6֒dG2HԂ@${ğ Ap-d"w1+Oh((( e _M Zź\xWF".ʤq#0O#?f Jk? u4;+; 46kg^BH:EPE#OdoZ^WƓ(αFC3=/z}n~ ~M sj9n7gǙl%]JFEQ_Y!(~ֺotuxj3}g,52oEeg s smBD:|M% FnvG[g;?O7 m$!r-Id`\䜮q_sofះl90q(3^ˀLng-#d=2!ҬkktH8pTVQ6j^}CX Ndg:º.ՇcwsrcRth@H#zwƯշ_> )n/\Bqa #9O?_#m<~)շo3.4;`2~VDz+c?|CKƞ2,{oVO#\rҺ'2߱|;\J[n[i1pk ::!mWZ-MqvNW%m1HNG;.yao'xٓ!.%Ky^`9C3#s|2O-gt:˃H8P՟WlſOk.]KPm>[R\ \-Q@t_|?񅦱kZLJuk-[jZ}Zڲ2&F20## @_ Q kc8ky ˺4 Mve?1i )lQf8-ͳ|˺7Bf:(`MNV]7T.YKi%.wB+`Cd3<;tAEZMͧ\ scp*[:F;W{ Y[>($?*x4G#B}L6gl`{cL}X~{]4f~Z+M%gL^K(?eeYbzvBŁ9c+*Nrr25[\{o̡у+w/8 k; wO&/QoVqr$#E|p9,9XtkWR[_[:]G%GW@6]Y1aXR_nr(~L,{5uGULȼ"2`oT[Q|']iZEue6e|me:~0x7tx7=:qA:0 pEyWƟD+omzg? zX>uy,:J~ˠ<#];\m[6Aݼ~U u]2V?&3?r\rm:t ҵ[ uHDf܌ $ 1zH_?v>tx|?iPFv.~F! Gqra3]@Otolo>:ՅğI5yH7i-lOv4 ,kοؓ'%L7SZȱV{i%&#<6H C;@|'m~^żt dcJ̌(Ҩ+ s~ S;lw :U:%? O&߳w>%ٴ'š?vX=n 3_'7 EEl֗i9C+ :XW wtf WHn1&\)EC z>ϪEyD9ZT_yLK*=cs\G~mk;װ6mSRn Huƺ(54:w[;5MJGU%4HF(;C?'i¿ ~o -0$0 9<ldy %`vTD(I4og_'Ē7m߉A)dI:qv_" !=#65OK 4nZ;I|gR$$rGRg7 xw^K5İTnV ZGn0c'yK ?o3_$(ni^kE:gq_A\eo$I0¥݂($wSO Ij|'c&^x5VvbTrʣ$7ST?k]_/Cit h4m9XlM#WP>-X/Í[w,}kXXT(v ( (5[ ||b:g6?IP+|?CwWg?+)tfy@0XPEwK K?%쓭|FwEi5A%c_#JbJ1oXj oJ oa[1 pr et6|I~8qc4>ТbR5!]IN]~q~-oz|'g{%V<{[Ck+- y8K&Hdz?CZ-uVEMFߙ(UweTQru=/Q8|FįE7U2S/$,l] |X%׼i-[Zέ0Ե亹rT`0F ׍+;:ŏ KMVk}nn-$ıK x^1fGoυf2\iRhL'sΙA=C_b_1鮢VM:K]bp^ YA"xv ߱Ʃ6|ޒwOMC8~~h :~3MɡVڂ_hi+Yn[y{k&1)$@0 AバA좿__YڋgEG ~c/ wO8ߴ> ċXPR)4[>d;]##M%6GUtpUC_?w1|vǖ-A̖kO 3{nm8PN *@<~|~>it58o$6;XAS A?m}j~ᇏgWd<7nJw|VJVf%˔'̯ mu<ռ5}#&5 F)1ϳkW#@\h|w oFxMGu|:=LUe`YHe` eE}B CMAY M$ץPi;u7.>Fܟ+LA6$?~$KH?,tFHIyJ Pu IȡVA I_j%m59/<}maIn\SFqIrKDUcf9T(/t(7K­&㖁j$GKxvR>T`FZ?Uҧѻyg+Ksor7y4oثmEu~&޵Zm\[]F!Ԑ~A׊U?`} O~-oQ5 dܶo'wD _ok+ԖO}s°]8KQqcwZ̯n[ 7a$p>Ӌt8ծ~1(T,(Q=3O3<)-"C5KNpַ0I|gqrw\zaM&'5!K4:=>)Z0#R`e1^M@M6?ƟuM-s`(So"[ "aА>`Կ W #Ƭ]Oz躍1$|˽c'mzi:V.'mX1ɎE?tO4hw>j滾Kx! 7NQ>~<;:/Uxl.Y!Xi's9% R|D+׼TиdQե\c)BTQ_e>?WR I'pW1F.I+]A]5~-ρ%폋%[xkaH0skhwl%ho|Bnt|`>.RHZ2O6>[0B M>x;_I>/?@-44KI3K3I$]QESi]Tmty.enFY@ƗK+ qdZh[ƗZnə,ZI`!9_SOǕ|zq㇍q%725 rM1uruvRrA+п߳EݏHoڂė7[O86 ꦿ0/[ [ Ǖm/_O$)?^m~~K>I]NB X^Zc`m8!*j~ď.OT_7w2\S)\pٿW'g&;'qpp+(hI}5EP_{EW._ t33ő=_55{SO"zׁ 44?oÝ]KFt6뫇E J6*3 ki[Xmbn&H-,ĀĐ $ <.eh?[W(7i~x &O*/o~._SZ#\.&1E#o 'jizE\>q ^:_ڀ>\l_Zeo\K'' ;?JLhլV=ٔ  |&|JWUk)QB TW߶o_Gඡ^(lr6J>yl"p 8PH+wGj"?|@աf.V;Ii[ȵV4OB]ZQࡿQo_S_<sۓ1Ɇ"r f˰QٶX8w .<)K$m }FN ato/-̡=iS{xdi &yfUbڤ%9qԖjŢ?h Rnm*vMl= XKe=1iD{`cPO(gO'w1Q=lZ ve)h wMl|e_Ƃ^O<=,?ʬap!1`r95S~˫|h[kFl攰QlaAf CԼ 6b!$dV\g \WgZ_thu-Rմ++Qꮄ hW&.< uq,sbK _'w߳]|ѾϩxB]GtH@ %yg'$ ?(^yJ lo3K⇂?o͒-;Q)cdXv53skku6x_^IYNqŵ/y 9hn<{|?Ԯ7Wk坥imh$yK_uاF>(|0Z$L P\Ho3ǯўM[1𧍴k TPD=AA'X#I6 ~ _y:mX<+[b`| $d^:/f?j ϔO?uA9LN8lF ?kφ4 {sj,VxAi`yˌx/:o?i> o!4}rB#;%A$r)>9ڧi;ᗍ,SPߌ4|&CH "0 ke8|iėmx/V}.yS*?,1kEt_շj_YI@אּ;0<~!W9ax7~vMƈ_žˆAr)Prrg'㯡??Un|=KA7,+pXdml.YW #<៎<uݷ5!l;F'†܀X>.|#7?|m\hzև4WV@A9ݹrYXv%|;]wnm}C*AkKD~|SqmGoXECpdW5=3<b8!rWTdjjcDXemI`̤AAA(/^xhi'Ec([2E-us ~|KO>*𞵦z^iږp^B*H#H.%kXd 5K`!rHufi>I1 0Z/ؓo |F_Eh7ߺ&_.Lx Rh((o.?U_xo?1hɡ뎛!գ\az@$I>\- toК(7S߳__=ޭh3]J-x 0J*쮤quc? ZK?4{cb%ݪfg䏼B !?}φn|5؟6vi[*.-ĒAt]7!Tu^4}S@49{{ *U``e#6Xƛ7u;x{}n>ldDyj?oiG E x>sRY5wܚUނs-̱ʫ"E~ x?|8Uv~&nu1 $ќ;"CJ2 >'kU#:ok4`.dO1X/#dZ_Ɵ x",|N}, oqcq{m,39I6!t (koc #yz~%)F8k{8;m, Giwiż$H2Hd0#"z_~_Li2Lכ1i1o13`a c< xЬ&xG/twb?#<_ύs_P/7Mb E5eQZςw  < jv}5뉭H `@'Y'= ׿?|g֛gW^&!&Cbey++pЀ1k |ox[:uց7i{iYh*G6+5? !|ql2co="y#y%|Uڏ\q1x"v:nrBh6 ߰+_?^u.Iٹ7|Ԅ)$nG"GSXA5af\~Ͼ>iqܼjB|!@<%:n)EPEPEPEP/0W|y&h~l8|٣pʹDPū󮿥=7Yƿ/m%߁54-BXJY_ǕvBOo\g柦 # fvpPŁ + rpr $?ln'G¯my橫i6|8 7MUe< $k4+jY|G $oxJGY{E^#$3N͒I$"((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((('LLwQ5[Y ~x/XLн*g&!,oYho)}ZƺdpATp?/P_>F$q&ㆼeٍ6T $?fg5q"|"X<]3EX!EyݔIyD(((g?Gox=3~.5mJ9aH$ɮ~I*Oy$Iy(a. bAԌ~Dn] #bⷉ$5M6{yzVhG'up?~k_ð|mVq,4rI_gok(+jV1IBZ&mV<0?t.یLg@?O/ju4#aX4/0vn֝s$ܲvv5se8CKS>;xշx cх'c>5}A?iH?c؇, j Ǜt"+mvU>7fiZI$EY,žfww EtRNg4{Hu0,|`0 ^%//2AGŏWLjQx7E#̆7#0%܃qS?"v:$gW~KLD8k2H#b!>Xsb dI^3:|9`" B+( ҿP]7N4l{wĖЅ3\Xlރ~~̟i?*񶺡"tB As9©j?a4Sw oB̷vMEM+wx6þ LJ#ـ Ӵm>+Xj:~h_AMǃ>q 5-1oj3pI'7q2>G}#P*X=lR?2|@BA?b(d=,|w׮7K֙Ӟ cῇ6=0yjuVQʼtzVQE_tk.Z'P<dmpG8 zcچ X-VgW9)qk*(LEofv:cPO!qn00 aOXo4Y7Uh.!cѰ@% ]̯J?T"GX"h~&EM[BRFXоQtW_T%_'o͙6C'-&<h"s' @Wogjv?~jVGn|)>UzM ֣dhguŚšgAloR#oކUZddF'~4xEKk7бIW<_ImmX$ H @d|%b|? tHjٵmrEq0#%ƁcMjEQEQEQEr~;Od=xX<+{7oc_@2Y 3$?lo|M.0X︽H*I   O &}_r3Zќ|ͺdq,3WZ ;+O I/ɧFw9RKq.Q~UPEPEP__l6 5v[~!dB[ 7Wh$2>b[v4yC|X־NCZ֦bvn o9$hFT 0_"wkb%OX]Mi^i_D;"1,/=<~; "|FRG/:. C`8UDaq6 W/ï/G!?:~A~Ѭݭ뚔7S (@#D_1| WOj6]I'#3*W$dq\mQEQE>>A.|?x_ſwqkڵē\1߇mcP59!H \[(C|x8ۓ G /~+xIn#MzH-m8Ap(ţlaE0[O!G?+R#.TnJ* 1]7*T?/ !2E|'B'ע~>,ҿ_+ை> xAvk:t cʕPJ^926hčsO4GVִ?hr=GOh.rBʮ0>`w1~ǟ/ڥsFK/alèmr,2Bp 3,o~|+{P<)^uh/7%⨭l خ!Ӏ3EV|kx#Z/Լ?yՅʦV"[_`@M@֒0 $23 vr (+3_tRO?o[ Fz, ._mJc?mmUҧ5u#bd##*Xhw]om?U)!a-]X0# aN ±?S?ϏL%󂿫 O?i_,m~ +xsV\f`wmaEPK wm%CȥF98ִ}^ 66R5xEoAm'LφI Hr n*W,7NFhWL~֘]imyf̚x>&AXݷ!^QEt|P"Wֱ*gX#ߜuyEw XY ijx[J-P XmHOmφ>>K}zKX[b¨H G%ݣmo_@6?~o躧k>]lr !אn~͈\s9#}K6:"czp mu:7Z$r܃PpGSmѼ2̫pG$r+HWpe+.ك Wן/&? YEUkVd08EYxbh?0!I4Q_O%|59UQEQE|f eۮPoˮxxM ]x6fY0Nw+|,[˲vJRѸ-~Q@ɿ5gmŲ٢_0IRq!pXWϾ4!֟4m_v1@i>T|/|w *!?p꺓zcPb@?(Z ;|z崿f9B)|?&B'~_M??iw\+j~i$'!yQÿe80c;FV_ |eϭx$uqONM:05[ >Xc`#oY ~xúˬJ}N $I' pBEQEQMwf!BOP~aoُ7F$>!|>]ʕ>(u*Arx``p17X#tKR7~hg|WcYwyk '$q#+^MVln4{2i"kI>\NFGZ+~x6n'5h4"X-rY̎HD'p5\~^?[ <l#q5ʡCKu+4B#L~L?>[3Ax2G^QcH:(+jz⥼^,@b :o|ɷuOݒIx5^Iź:S77j\=$m(#.yL;{8Xv7p|Z aqyTr> i:NyZvZG r_?MClW7? i y5mSS&BXkX%yOѮ뺇k[Wԯ{Tqu{r]\JNK;I9Ju7úk!JmBIvFYp0\NxLj"xŞ7$m浨51p8\/;'ſhcP-l4{)JnPR(;G%sFۯ%t~:>]Ю_J >x!l4pxX ~~_?g7K%< xwTԃXoúlKoco>iBi %,C*(xfj~*Yn4#P-NVcL~cV%_oM'߉>"|FRG/:. C`8UDaq6 WEPEPEPEPEPEP VGT7><[f?'LΊQFx$cx$~W~^(k?\o|)~\DQ*V{G#%Ȥ,k]>;xo?~ό5m:}YyW\e<)h2{tGԾ:|V⾜ψt|UoMې F0\.sĞw^TsNHq }!\~VO+=ܶv93K1(Va.6?(Q/kOH̗W|REZ֚L7xԟٯ¿? BN_XGH17uUu`yVVk5۟4w ʿ04R |#,ұnKBr8ES?f4!Eg?7<6c>,Ӧ;9G<G9 9R TC\_0I}{;9SSUjs5ш>0XUs_~eKaxfŤv){/&#$e&LYpNJ&Bq__hGٯ/ iOIO@1(#8lJn?>4}wG՞\gQ,1J7C#e(Z$ڢ_>D)#VZ'X%ڬ*t+*dY̕QEʹwC4q Q2<Gj6khcAQDR$TRE*ӿW_)M;N~@EV5M M!]ɋ]o/B 8vd +ƿjGy-&4fM6Gܖ|S#)ܨF| o_x:,&|2[˽oo(etp ,0BT8'EOLj'xT}SŞ$7wE$a"sH}U\ |6,/5M1Y(O"JB0gtl\E$mo'ğ=bAN.c8 qL5 tXE芣=?=qZ5&~%trc;v&u8<̮*->i^"=kBLi^-}nDA\^U-L ((k9WU#gMx`y;Ǧځ`"83 B}'SeoĿw~,<9 K>B;wgc_igvNjmό)@KiᑕCs $D @Q@>!h |xڥMZܞ\V!y%v쪪IWjUo&C4>ߝx?Jx6,yx\J981q5he,؇Vqk0#Ǚm9"O< O7vǏד/N=E] M€0,SgBlY?w/Ү@hUHi$|֐H9Dw*Hֈ#PWZ_'e7/4+A>re,U@H(B r>Y#i? <^Ҵ=mGPio$UUWgc)/w*}2|=>p7) ((((((]">+4:$~*&f/bm࿻]Zoj RnN [|_'8+QwǮ^G| ^M]lc|p$֚GƯ|b$G&n_͵G ѣ0Nd-_O,(׍GmiFB0Y`s2B ⿍; k~*u o [QUNT3(%<Ɗ(_m[ +I mNdWҮ˓ >VVU [ aa մ[\Ʋ,mdF 5ٍc' څxojL*fai%vVA( 6ľfizP`aWSE߷m=mO|'צn,;d3??2H92Ĥ(=Z]j֫2#=UU'hpM2}oO quL@'fHrKYT:;3>5O xKE5-J| w7 hq4{[$CM=c7wX.-:'lH 7G/~^ ~noil~eH(((((' YԱ~& 1M9N ڔJJFb~.?s5cB44ӯ.$}R`J8!G?3i^*{cTH YB3è)Ȳ(J؂$¿/~ǂ|A[u6̶7Rx]OPo%ßS_ؿ4 ״rͣj*ؒ*F nl ⿈|WJڦ;O\\{A.Y!Z/Le2 TZh.gMQ/Kk$Eqdta+)5j ( _ KoůXP\@amj??j2ߊ_x6Kޚ_,c-S<^OBM| !x"& @RKq+n208Rw6 XQ@ë;5⌯j41%~gwco%_/-d>:%E8e6vLj`㌍<"j(W?^9]hd ik&q>Ҩ1I@9T{O5[#h|:|k[y94(0r?f2SP5‹ɴ iop7yww[(R~|oq4֗_Vl5?p "n1Da* @QEQEEW"$>+h{}W_/#ͨM2@@$ 4xi}QY4Op5 .'#-А_f_q_oBd>cK%TjFczr0F ku`ҵM=t-4{%{C /Hhe$PQEQEV//IKĞ*4 {Go=N-m,QI! =I KB{wo>.kp9W6qL?2TFr@4^qO14~%xk嵋zmI3I?k/5nuWѮTݡFgcI\Ēɜ^meU繹c#\I$KI$y9$??s7Qg( .)~1,pߑI`k̵_;:-W @I ry=_]iw{^M|F]Y|2P#1S ß:%w-41uVɝ</V` e@ J?g.ķv~$k'kkf)ǟ TMVwe[*2Tq\}ee5qop9cqdV B2+a~b|JtwmGGFVf!8XP)0wWrUm|Z_>)*Ɨ!% Zn*"^1|x wѴ.8.'u]y%#h9~զ|D2Z[—> ~gKgé8Z' DFp6mP__HDP~ѳ?m$iȣ\%+|ßGᇇ=zV!UAGD(gmnmzE<4;I5 Fc'}0z71$_[JSd2~r? zI?ӿfڼtE.?w}Jی7j7ᇀk ]#öwci$nH*+!wNgᏃn-jz$] Y]2bʀu`Q3j3#Ckq m[[&ayɴFpeGG2|C%2~(>x"/CecʱQT+WP2w:BuOj=y>TiV5"]Wsc }7z9x Mm xoW7fV(JE#θ}*3mHLZ|9mx8V;j%ֹ60A[1;#? ~Ѽ5/iַZ]ZP#@dQQ[CѼ;Nfqkόc[{<qgW+ϏقIaBrGs~^]3Ğ8񄐂V#<݀\@Npq_uoτ $>oB u Kq]G@emɏ fkڛS3>y<%?宱xZšu)n @"9!9,ps7O[⿃!ZSiIq EIώBΘ~u@LhZ࿳Hƿ`y2fotbKK9+ Hg5_߳_x/^|? Ǩ麅T)![tAVсW+##5i!yeY&ą/ e9('ȧf>@<37m0]8|E/ dݘH۲pOƟI*XZxRFkqg>s@%Q@7\/KqqcM <ۄ̌-&M1j{?ώE ÖDl_|Q^&hE6 t,z:2 6|V7&c~)? aú|>"}]oZh^`ml0e]nh?٣ fX#x>i~8ԕ#I/g!֚m$ERz83 /m|3ö:^`q p8Q@Q@>*U\tfZGpu¾qM?hv|MO~'7w}IE~Df:/|M,Q%j Fc_8N3ڇ s\|=-i#躔 C@FI' O4PDd6Oῌ<\$YIoop%&#˗܎@NEyM|63W:/4]'=Ԭ㻶z5n4f<g|3RLK)>P Ō{Ph ?a:U`1)MKp=EOfqKh'20ʲGJ?e+'5+X|3Rebw !I[h)  t_gHm<Ζ-"GaY~?e;߰~3\|-֖+ČR]3Q r.!`T _=/~ ~"ksۣ9%Qq_χ>\, KNp+Y(㜎U?C_EiCڋ OWS^5EեpG&f`83$ $~؟kEg~6j߼<A$rp/pNs??Wݛ?x'QQ~B>Ib`IMd~Y q_?zv㶛kEmVᥴ,q6Ќz?d/{ÿ࿊>vq;Co&?R!H3'XG2'|)J\ĀƗ@`Ҁ ( ( (>U~KO':xUmx{q<+$ eBI8tQ@ xj_eo7>H@$i51mJq~A7ZOUf>9+E%K{n rIP|$@Q@Q@Q@_] }[|n4]?R>t1:0\YO UZjob&/Gkh~-ݶ拁_mcG5ũX\iBZ pyv99_ޫhM]ꚵi)Fe \_n/~̿|,0i~,XJ-HdĞNrh/_'̈́ڏ`jB?3n`U#n-ʞC3_}1g%}'\J78a Bh_+/ 's3ЖdMУ$ٸI7wng DE]aOW~ǿ/ݗ>WRf wz\\Nˆ0Y,F-y ~2?R -bG_>@zqX@.*0T+c =)d|mK?"dK{0% ̀\V4#'R4XB(ڪ O _O46<}hM−h.@AT((((!Oه -GY>UԯR@4-_YI ">ު>".mGV,t>nu;k,M&Gh+McWeL ,|I}r$3k:װ> $DQUp{}SGuyL-kᔗZ`੒Z9ߑzC4|6x]-iA>Ѻp+rS 5tPH?_ : ^}aysjKA$lm4Q@ᗅe[U9#ZDr)_v݉"U?vdoB,Ӽpkd*Grm8,_ިa:(oP_,=J{hHIU<Yk еLy|=Fmbb9$a#o +_.>MhL ɂc@!袊((yGXK;ڪ$ W-{|.p| y"`;c^(l2 [ے,~w%B׿WeMZ Ŵgy7/ܕe,x1QEQEQ^3wx?&a߈+hվ=VX̬Tdȑ\W?xE?|xtxIE !E!__=k7ĚDr p"P##cUmA i$H|;\*J@H\k,y.t Ə';4s;r 2p3 @?h?ඟT/w|4[xvgyx#1qțv s%,N~bg#T&?{_Ý+;mGQV6n[NAϕBJ|_g~Boڋ鶎 -/23&FӜc;L:IJE_M?6xyXjZ\xĖp(?5nߓ4<`J[T:g}|\ 9/4/;> :ƕV#۴'٥p8$:(?$."ٯuNNWiv G'MIO7'U[|1'XhnQy%IH}E~bCEco\C>>k.;GL51il*lMGt\nm)H >mGo@X|T޳#oX*|;4=:71 Hݡe(>9\HtQEQEQEQE~? o/|2_3ۧ7}xi/;b6_-_L_~O3-m|3Yu&fۋ ȻGk䂸{G(e! Pv&ek]Dx9;cKJUUWui|%}JM:^TWe6^_ o>cSĎ EɔckUg{1~=l*8-]NH^@ܠkQEW)TT?7tO5iyaq'ĄdಀAb_OaI>dg-q ƚ__k> zY-u}r$!K!%Y6DfuR\\I%Կwgpw1$`֟G%??N]-n8 [.jXn>y }Q:"99$>s~^ Eq"1՝YĒI((((((((fg;_S;Ś} jRD|%'\6x.O$=Qxs9b|ҥDi T+pee#['4ojGI/Ȗw-ِyQ|/^i:vekEƃU5((iitKk&c/|['6ֻ2>B5 |i_}c'i϶5<]0F%C~NEPE~^'׼_PWﻐq*p~E\C ?ᮓ'VfDo1_D:>,jVɭF{%l-9&rxUH%g |(7 u_xė1na%IU>R͒Fb0?"g -#_#'c[b /0Fk2p˽J*@? d75ῆ|W,4+;!z'SpS19+?_^u4iMw׊xmlҥW6jOq'>8;-f{nm%', v|#\7>7~IO4UMV>Dźٛr@+-oWYlGifkXgB0U #?+k Kc;Dy#) [eَ1nbbs??+ d}KCIo\3^0l0*<3g (׃Q4xR7/|Ғ4o#˕em|8ޯo?kg{{A{yV6CN ic8Q<@UuĚ=ޝZX_6$'RVRA+7]íŞT}[MGumk_xIS=JkWFHv?vHܬPH4?ॖT?^6xEC}`/ģ3Nf^+S_`OJ?zWHZ;,^yv׌ر )og,3(#8*!Q@-o''C:6omL#739y1@J7=\s?n&湬{]x{tOUo2rAn?W?o)\gĚ/YGg \wd[6*3_@NiņWIuo=8^[j|ůz,e?/_Y/Oep[+qy.ۺ8= PUo8-{o< ʶ7.g}ҫoT 8}s%[_֭m-Q$yGpGh_w FS|icV>_:hܹPH#56M5tc= Rym|`+?7> tVge}ޞ>9|ӂsdG{ \k7|5x7MѼ%me]Gq-Cyq t9QEO]ϋ>!x\$Y[B؆2 +XC ac9YEj3YQRe@2O!@! XEQEQE޾ c 33$˫x1W`PnpUԩ`FPHkѯ'?l8[CHE_1|G#+h6>Ь6M`K[KhGHR4QªW( yM؟ƟE0h|yڜzb+;`/vj~ xn௃FK{ S9fyO@?-~/|G8TUMxj渹˗d۵@O"Z~WeWS񖰹-gbug>ۼ;k ڗ|?Y:,-ĎJffڡ:!0%?Fx,B>2.5_ )8f.E}Eo |7!M&C߆Ӵ XCijGO$䜒MtT7V]\m,V4PIb{s@_w~+Akd$ET >pHgSֿ m_E?࡟>)G<~]7ñ}i01*#|M|@_o/|o`&N 3 w!6DK43KgsmOƊ8,[ G#k0nI}[mW~6~7_ ~Fq 6{dp"ZDV|@m'&?j 6V*i/~c9xxnn:2083$ԆIe="<(+%c_WĽ <_k"{q ʠ$>fqF9+n3 x>$Ibfl";rAFA xz3/"[2f7#RWo\o4/k+qܯ5 b|*ᆿRڟ, Yojo0iړo0߁cQ$ U9|'/kiOt[\g$ >'P'ğ&Gĭ&Hfv}/TubN?}P#r!J?|?d|=~׾CZbMx˴K#l(xteVPN/[7C-& wÒyJ>F #p̍+.y;@Q@~hg=4--Keoi=L ݦGqosm_lij~ ,Hچ{aA$ '*?( (>i~q_Lj:/sB}hQI\U`;,g_ax?z  = {O b  5n?౾-7v/ky#RKn-I緘p9E_UYLx"s]7/;)Pz܀JQEQEQEQEQEQEQEhxwukXj7)$R" ĖV6ŭ-DŽuYY8K5ϟ{ УĸW9u~>~^ _ O..bK\o69a[* Ivz5sl~xN!Ώ曤͟5ՇGe1Q`LD6HS"´a.u}?߀5i-58|--J)Gg}+tL?s(((((((s^?xO6就*˻1 3x C%_Ow!&,WOJ& Qo^"ծ5_kһ|űA/`Gs O+7Gy K&N,Vy@k;W ao|U/ sk&56.]Uc\>cq$P7; QCWKZ/xVvH~e弱bYP6U5猵w8 K`j ( o Qiw4}j\q5ܭY+s#F#8C*|!9/Uol֞ +nH~y:IxnֹM{S Z{KQ&ó1b'2'|jxݵ-/;a7|.¬Q`pzr 7/.I8$g\1g9}x0S.|L~|('Js_ao2e#FOo!Ӭ<{=k<xPfF]994OX~גGqzṂ:ljh&2|M*z4`x~-CxY? }AJtM%Lz]E~+d;k]72v\6x74>+ a]O?. pOePA}mmpp DE `ڿ7z|t| Ҿ-վ&8 t2ޫ K?j(+Ou,uI ҭHیeg*s/Sб+A׭|g\JcY+Cm4KP 珚y; =5[G?_K|WhJ,p ź点~=\k[[<J~s 5+yWsx8i?0<zS&k6guqQ"- mtd[k<1_?^ڜ~֟Vo"Iu|7,0?q($ɒ@Q@Q@Q@Q@gWO+o/(O$E}y)HSi~8Ro 0t" ]cw߄\)&w>_l*TE5'KtKPԯAmki\1cjIn~U%IRO_'-\EeW96u@&.'l ?d'?Sé|'kb%[[A&vBMIM{=~ %-m_If}zCIomp3N~o~^ӣV e_ 9$28QNID>e&X 1PuMA8r}?73)V_<6+)ԵI [Fprr }E~cHFcOi_|q֘gO4C.{ it!Ci /WuݱRGeuoUi i١-5γhw~L\Fj@ O;Jmo/V? IžD .gT5-'%r'[j c/ |B%ռ?٧8B Z6MmX?_?~-[i|:qthYvfڷ({yBH|PEP{%k7$l* dʼPdgEWfxO*kvE~^3*FyonH p c|q?+o%/%qt\r|2 ^m6xs>;ڵ^G3j YL9\|E喀 (@G8xx_xOX-IK\:U-T!W s|`um}ӗgc[xcwGU799 ~-յ CP./KdPs;|bXfff>4P_HO/ixs| f.5-fP/p)' qBWcΪ(@'|0-,O>4Ijie387S~c;oiULq[22RW<⿎(_?WkM:;yݒ2T kW'08w-躬N$R!Ђ2XM4d/M}uNr!aYH9B_~qs-*o,WEv3d0IrR#Sg8YYee9 B :(((6g_)e<|m2|8T )8•_d@ Qh65+No,g\g%i6ӯ5lO(W'okί+iqmXcXHx,d ?¿S#hkW/-t@oڏടoȷ 9~f6&72 9l?nφ?+hBLȊ *{JK2h-o"Y3eF _]cnBߵo wr:DžZ4WX9"@%[B( ( ( )O_tHozi u9ExVvq@9b_9cJ[o25H1#e_wsvzQEsN'']x6:-%-"n!wmr8= {%|Ox>$m[,+f $HlPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP@?o5_??]JJcYYl; /sks_/WO#7"&^ZDAm qJD迱^^A %b+9",_G n?cCuic6[ SxPih:ޥ\eXl6Eea\1Nw?Db?:_5~Ŀ_fKIhDFsر1^s~)@|ZvzV -&x+ TIP5 x·A#2ivo#$>~[AF`|A+0ϖE~O=/C)Q>GhUԮ l4'a~!~&~* ϭζ~b81B#6[gnf袿j?6~Mw7bي# iF77NŚ*:ZLOٞOݦI?c؋ v +c+LcKFP0gy{OeV6zf–֖v0ZĀ*G( \(((+OSƞ>&? h8a3Tbp*" y@7GOW@x⿋2"-HzQĊsE|֊(I(Św? ~ֻ}nwOVeHB8~VxWԟ/v+xi:}_/l!DU%8‚?o!߂e¿j.ɵ=U'n3J2" :袊?_(o=<h3A:ysZoe)c6)"c"?ടF!~;Z\]ֽq$"ۘZ w}l[\6/#ccx_Ι*o;ݵ\ |o< y~Ξ"cK]SÞ!i5W0T6)$V8Y\.L H<Sk$X۬|!D|UG82C3.jbD %ca R|5?*W}]bƚntفM僋SI "[E߲+o¿w!dZ=>ayFrp֟B"j5=֋FYp@Q@|.|, 8C5hu+$k:dS4EŽ &y1rT9u%_fsHdҀ:φ?_O kEn2yh;Ikk'k} \BO6%$k_:Yt$GlLF@?@EP_Ͽ*HGqgxn`1IŰ$kgБ"3O?HM\{Gᆽ kI,Wl?{Pk[7>ν%m$c8גSG2+Z_i^Εx KM;Nqxlxi>.{~e4l2pJ3$52oJc TڜfY2Kڜ8[V?+O-{Q@q)/~"|;u(e#d/wx'h7/tVO4xn,GHAGR <~_?]7R5/ |-`l(Xxᇋ/#-y oo˶ٵ#OjR ͜fIrLҿ_<# 'ִSNִ}J!=\]Fz'uMw 5wuz`U|AR<ž.Ҽk\Ԭt}Ko/n%gF!U@p+ }]6m+ [94VYFM,]jZU u/Y5)YZ@!.ǒ$n,\ 8K o~Əsk׀=؄ " Mܠm5POBNJo$P7~ZLBV*@nAKML_6eI5mf,pu̠ ǖڀ@HUPN@8_$/ C_mc-5dtUmjYu*9+|H-ixzےh[TgVEYt!9ۻ}QEQE _tw_?+ @~G/,OunoX fGxSԱQESF 3 _|uGosMKi|3DRi0($dOd; !aXClG;5, 0"BA@|O&W^%nL>>aoxMPnx/%FvF aKJyq+0?1_Rc:n-σ~ = ߫pRZeq6Qg{漼idԤvieiK$dH`JrX0.(%? Uچ U4Ěծl0U|I# ID'O>vuWU , $`ȍ6ƽW6M'߅|;y[pΉd[x|ٔ~o k'_}![!_!im90;p̸-_ygZ̶Kco N,7wp*8~@PEO7O>eq*֭4h]Pʱ=ĩldn8© $;Ŷxu ZVKM M_G}~+s<|as.Uh/OUZ B?͢LC?Uk4$? ~ ªh62HmU)3 _+!!?SgVGBChЧ*ƀ?3h/OUZ B?͢LC?Uk4$? ~ ªh62HmU)3 _+!!?SgVGBChЧ*ƀ?3h/OUZ B?͢LC?Uk4$? ~ ªh&~)ju)L5ͼ 9A CM} +@l}> 8vUUP6I# >4:[.-Pi$0K'{11bQ!NUQE|jl7(Lki` pJjr"|s_ů{"յkPF ?F%9'$9-_y/>)~ӞGq15oi V1YO\8##V2m&kSXOӬSHc's;'4# Lj$–w}HS2wIs ab~z_}O+5ׇt}^g7i(ڊWP_?sOƐ=>( XH8+'0ΜAjqO>yLKB%v`5+vFU-ce,Zi^d~?fᾌڧk=:BчctюNUpe5QCZKQc92H`?z+?o_a>3|?O&TmdUepO-B9 xWU|;UT deR]H+;dM~ Z_:η)XC3p(}|&!oo ő|Gǝkppxʶ0˕?ɷko$gǸt=Q|D_AQH-fU{ Kb|1 ݫ^rUKbV6!K3r8@čmR{ KELմK-a"o*Ee=Z6H(`m~~6> įVY]$Ln|C4mfۅ~Y*{MF?OY7~h\E&0AB"Jéb/CxAs]i*1J8aס \zֽk׎\\Uy pD.: ܞ$ }G߳ /Y}gkKw y1Fd@T)p*៎_7^|OjԴە*H# 1_%}I|pZxnEomK S\ n"X7_?+ N~Ͽ@ Uu1#a3_vWVP[MŽ b& R8 #KEPEPEPEPEW5K]N ;;TifyqŠ2YxY7>ȶX|c 򄖓:{O}-niD4]ao'x~Qd/ XAo敀8UI‚G !;#t %Ȑ:UI;2>T'-#m@+D-LjF4>Vj#g\gn$c+L97qXKx_H5s\; =>.op8KX0R@;is,>b܀#'_ӇU??4XaZ0+[҃$8YGjh*X\5 oȃMCi?(HH_=&xm[\M\HJʼnffm_K?c?7RӴ[1 j!%Xqq **A'1|&fpK[W4Y[~mt +qNz5whE]> ;Rh*@8P=k >51PF UEQEQEQEQE\< j~+2Mc"(ŽOkw'z@^$~ f}x~K-WM nmwd sbR渺C_YI}a៌^cڷ` ;£/t DN܍|ُ߈>@|cᛃmygr teäHpہeX|crD$g$(SD=vӌW_?f7'uy|DK-̶vPqlu"_( ES 㧊&urFG{{qDT'r i7>ύ.BFLI!'